Trading in the Zone Master the Market with Confidence Discipline and a Winning Attitude 3 pptx
báo cáo hóa học: " Replication of the association of HLA-B7 with Alzheimer''''s disease: a role for homozygosity?" pptx
... pooled the two datasets for further analysis of HLA-B7 and HLA- Cw*0702. Possible interactions of HLA-B7 and HLA-Cw*0702 with other factors Table 4 shows the associations of AD with HLA-B7 and HLA-Cw*0702 ... factor alpha and risk of Alzheimer's dis- ease and vascular dementia: a case-control study. Lancet 2001, 35 7: 436 - 439 . 8. Small GW, Scott WK, Komo S, Yamao...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects)" docx
... aimed at avoiding overloading on one single limb and maintaining the weight on both the limbs. The presence of small feet in PWS subjects may be an additional factor explaining the decrease in ... respect to the walking direction and is defined as the angle formed with the line of progression and the segment connecting the marker on the V metatar- sal joint an...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" The experiences of people living with HIV/AIDS and of their direct informal caregivers in a resource-poor setting" doc
... participants, poverty leads to poor care and support of PLHIV as they are unable to access the treatment and nutrition necessary to maintain their Majumdar and Mazaleni Journal of the International ... because I've got AIDS The community needs to be taught how to handle the people with HIV, because they are always laughing at them and insult- ing them. When they are t...
Ngày tải lên: 20/06/2014, 08:20
Navigating the Windows 2000 File System with “Windows Explorer” and “My Computer”
... display the contents of the Documents and Settings folder. Within this folder, locate the Administrative and All User folder. Reflection There are various ways to navigate and to locate files and ... the folder itself and the contents of the Documents and Settings folder will display on the right side of the screen. 6. Now the user has successfully navigated...
Ngày tải lên: 04/11/2013, 16:15
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... domain either 5¢ or 3 to the core domain resulted in a similar deadenylation and overall mRNA decay rate [33 ]. The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig. 7, the atypical AU-rich ... CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCA...
Ngày tải lên: 16/02/2014, 09:20
Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf
... formula for the de Rham complex and obtain a first formula (11) which involves differential-geometric invariants (in particular, the equivariant Ray-Singer analytic torsion); these invariants are shown ... cycle class in the dual of a rational homology space of X and the duals of these cycle classes span a subspace of homology, which might be large. Up to normalisation, t...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf
... have been able to visualize the binding of C1q as well as of C1 and of the isolated collagen-like region to individual DNA strands, indicating that the collagen-like region is the main binding ... observations, a mercury lamp was used in combination with a filters set for fluorescein (Leica I3). The images were acquired using the HIPIC software (Hamamatsu) and IXON softw...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... to a standard TLC silica plate, and run with chloroform/methanol/acetic acid/acetone/water (35 : 25 : 4 : 14 : 2, v/v). The plates were then sprayed with the ninhydrinreagentandheatedinanovenat100°C. Red–violet ... lysophospholipids or fatty acids were included. Interaction with lipid vesicles, and their permeabilization, correlated with an increase in the intrinsic fluor...
Ngày tải lên: 23/03/2014, 21:20
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... isolated previously [22] using the following primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before the ... PPI1–H + -ATPase interaction at pH 7.0 was at least as low as at pH 6.4 and not affected by FC-induced 14 -3- 3 binding, indicating that the affinity of the H + -ATPase for PPI1 588 H...
Ngày tải lên: 19/02/2014, 07:20
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... car, and afterwards met Carmona at another garage, he had disappeared, apparently, into thin air. Nevertheless, Dick and I formed a theory that the new auto- mobile, of which we had heard so many ... Concerning a Chauffeur 33 stopped at another garage, and I thought best not to go in there. But I waited, and after a while a very dark, tall gentleman, who looked Spanish,...
Ngày tải lên: 07/03/2014, 11:20