báo cáo hóa học:" Research Article Composition Kernel: A Software Solution for Constructing a Multi-OS Embedded System" pot

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

... 2008. [11] S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour, “Performance evaluation and analytical modeling of novel dynamic call admission control scheme for 3G and beyond cellular wireless ... desired than blocking a new prioritized call arrival, an amount of capacity C is re served as a guard channel for only handoff prioritized call arrivals. New and handoff call arrival...

Ngày tải lên: 20/06/2014, 22:20

10 398 0
Báo cáo hóa học: " Weighted differentiation composition operators from weighted bergman space to nth weighted space on the unit disk" pptx

Báo cáo hóa học: " Weighted differentiation composition operators from weighted bergman space to nth weighted space on the unit disk" pptx

... springeropen.com Zhang and Zeng Journal of Inequalities and Applications 2011, 2011:65 http://www.journalofinequalitiesandapplications.com/content/2011/1/65 Page 10 of 10 Applying Lemma 1 and triangle inequality, ... spaces. J Comput Anal Appl. 9(2), 195–205 (2007) Zhang and Zeng Journal of Inequalities and Applications 2011, 2011:65 http://www.journalofinequalitiesandapplications.com/content...

Ngày tải lên: 20/06/2014, 22:20

10 195 0
báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

báo cáo hóa học:" Primary cultured fibroblasts derived from patients with chronic wounds: a methodology to produce human cell lines and test putative growth factor therapy such as GMCSF" ppt

... display cellular char- acteristics of senescence. J Vasc Surg 1998, 28:876-883. 22. Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga V: Dermal fibroblasts from venous ulcers are ... keratinocytes. Implications for normal and impaired wound healing. J Biol Chem 1995, 270:12607-12613. 16. Saaristo A, Tammela T, Farkkila A, Karkkainen M, Suominen E, Yla- Herttuala S, Al...

Ngày tải lên: 18/06/2014, 15:20

9 487 0
báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot

báo cáo hóa học:" Aurora kinase inhibitors synergize with paclitaxel to induce apoptosis in ovarian cancer cells" pot

... and Aurora -A kinase. (D) Low power (2×) image of ovarian tissue microarray stained for Aurora A by immunohistochemistry. (E) Aurora -A staining of TMA core of ovarian carcinoma without adjuvant ... Dickson, San Jose, CA) and data analyzed using the FlowJo software package (Tree Star, Ashland, OR). Drug Treatment and Caspase Assay One day before drug treatment, each well of a white-...

Ngày tải lên: 18/06/2014, 15:20

13 475 0
báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

... 68:36-42. 14. Tyagi A, Singh RP, Agarwal C, Siriwardana S, Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C pathway as a central mechanism for S phase arrest ... Villegas I: Resveratrol as an anti-inflammatory and anti-aging agent: mechanisms and clinical implications. Mol Nutr Food Res 2005, 49:405-430. 4. Palamara AT, Nencioni L, Aquilano...

Ngày tải lên: 18/06/2014, 15:20

13 714 0
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... were obtained from Qiagen (Valencia, California, USA). The siRNA target sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, ... 12 (page number not for citation purposes) CACAGGTCTTTCCTTAT; CHK2 -A, ACGCCGTCCTTT- GAATAACAA; CHK2-B, AGGACTGTCTTATAAAGATTA; CHK2-C, CAGGATGGATTTGCCAATCTT; and CHK2-D, CTCCGTGGTTTGAACAC...

Ngày tải lên: 18/06/2014, 15:20

12 348 0
báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx

báo cáo hóa học:" Molecular analysis of the apoptotic effects of BPA in acute myeloid leukemia cells" potx

... michele.cioffi@unina2.it; Ernesto Nola - ernesto.nola@unina2.it; Carmela Dell'Aversana - carmela.dellaversana@unina2.it; Vincenzo Sica - vincenzo.sica@unina2.it; Anna Maria Molinari - annamaria.molinari@unina2.it; ... vincenzo.dicerbo@unina2.it; Rosaria Benedetti - rosaria.benedetti@unina.it; Loredana D'Amato - loredanadamato@yahoo.it; Maria Marino - m.marino@uniroma3.it; Alessan...

Ngày tải lên: 18/06/2014, 15:20

8 604 0
báo cáo hóa học:" Comparison of the effects of vitamin D products in a psoriasis plaque test and a murine psoriasis xenograft model" docx

báo cáo hóa học:" Comparison of the effects of vitamin D products in a psoriasis plaque test and a murine psoriasis xenograft model" docx

... 4 Immunohistochemical stainings of a keratome biopsy before (A, B and C) transplantation and after (D, E and F) transplantation and treatment in the psoriasis xenograft SCID mouse. Before transplantation ... 3 Department of Clinical Operations, LEO Pharma A/ S, Industriparken 55, DK- 2750 Ballerup, Denmark and 4 Translational Research, LEO Pharma A/ S, Industriparken 55, DK-2750 Balle...

Ngày tải lên: 18/06/2014, 15:20

9 532 0
Báo cáo hóa học: " Molecular signatures of maturing dendritic cells: implications for testing the quality of dendritic cell therapies" pptx

Báo cáo hóa học: " Molecular signatures of maturing dendritic cells: implications for testing the quality of dendritic cell therapies" pptx

... Diagnosis. Hierarchical cluster analysis and TreeView software were used for visualization of the data [14,15]. Gene annotation and functional pathway analysis was based on the Database for Annotation, ... Sunnyvale, CA, USA). Data processing and statistical analyses The raw data set was filtered according to a standard procedure to exclude spots below a minimum intensity that arbit...

Ngày tải lên: 18/06/2014, 16:20

15 499 0
Báo cáo hóa học: " Boosting high-intensity focused ultrasoundinduced anti-tumor immunity using a sparse-scan strategy that can more effectively promote dendritic cell maturation" ppt

Báo cáo hóa học: " Boosting high-intensity focused ultrasoundinduced anti-tumor immunity using a sparse-scan strategy that can more effectively promote dendritic cell maturation" ppt

... distant metastasis is a major cause of mortality following clinical HIFU therapy[1 0]. Lengthy treatment time also represents a limitation. Because each HIFU pulse generally creates an ablated spot ... internal organs with an appropriate acoustic window for ultrasound transmission except those with a ir-filled viscera such as lung or bowel. In particular, HIFU is advantageous in treat...

Ngày tải lên: 18/06/2014, 16:20

12 345 0
w