báo cáo hóa học:" Research Article A General Iterative Approach to Variational Inequality Problems and Optimization Problems Jong Soo Jung" ppt

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc

... 2008. [11] S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour, “Performance evaluation and analytical modeling of novel dynamic call admission control scheme for 3G and beyond cellular wireless ... desired than blocking a new prioritized call arrival, an amount of capacity C is re served as a guard channel for only handoff prioritized call arrivals. New and handoff call arr...
Ngày tải lên : 20/06/2014, 22:20
  • 10
  • 398
  • 0
báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

báo cáo hóa học: " Development of a self-reporting tool to obtain a " docx

... (Clínica CLINISAS, Madrid), I Vallejo (Hospital Clinic, Barcelona), J Vidal (Hospital General, Guadalajara). Milena Gobbo and Unidad de Investigación de la Fundación Española de Reumatolog a, for their ... greater social and occupational impact, and a greater variety in the Table 1 Exploratory factor analysis; factor loadings by instruments used. Factors I Emotional II Physical- Acti...
Ngày tải lên : 18/06/2014, 19:20
  • 7
  • 460
  • 0
Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

Báo cáo hóa học: " Development of a 3D immersive videogame to improve arm-postural coordination in patients with TBI" potx

... bubbles towards the participant, whose presence in the underwater landscape is indicated by the right and left hand avatars. The gaming task is to reach and pop (intercept) as many bubbles (targets) ... KIU carried out data collection and analysis, and drafted the manuscript. WAL developed the game. NDC conducted subjective assessment and analysis of the questionnaire data, and...
Ngày tải lên : 19/06/2014, 08:20
  • 11
  • 793
  • 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

... first amplification stage (20 cycles, 50 μl reac- tion volumes) used 300 nM of primers CTCGTAGACTGCGTACGATG and GACGATGAGTACT- GATCGC at 56°C annealing temperature with Platinum Taq polymerase ... M, Avila PC, Boushey HA, Ganem D, DeRisi JL: Microarray-based detection and genotyping of viral pathogens. Proc Natl Acad Sci U S A 2002, 99:15687-15692. 4. Allander T, Andreasson K, Gupta S,...
Ngày tải lên : 20/06/2014, 01:20
  • 10
  • 432
  • 0
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

... important arthropod-borne viral diseases in tropical and subtropical areas around the world and represents a serious public health in several countries of America, Asia and Africa. Last year, only ... (4G2) and pre-M proteins (2H2) Mabs (a kind gift of Dr. Ferdinando Liprandi, Instituto Vene- zolano de Investigaciones Científicas, Caracas) and a sec- ondary antibody conjugated...
Ngày tải lên : 20/06/2014, 01:20
  • 8
  • 383
  • 0
Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot

Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot

... uses an N-gram of size 1, also known as a unigram. The grammar consists of known utterances that can be made by the user. The unigram grammar is stored in a phrase database. The grammar is ... is organized according to individual words and phrases. Each phrase is placed in a table. The phrases are broken down into their individual words and placed in another table. The ta...
Ngày tải lên : 08/03/2014, 01:20
  • 4
  • 252
  • 0
Báo cáo hóa học: " Adipose-derived mesenchymal stem cells markedly attenuate brain infarct size and improve neurological function in rats" pptx

Báo cáo hóa học: " Adipose-derived mesenchymal stem cells markedly attenuate brain infarct size and improve neurological function in rats" pptx

... than in group 3. These find- ings indicate that ADMSC transplantation exerted both anti-apoptotic and anti-inflammatory actions in the brain after IS. Autologous Transplantation of ADMSCs Enhanced ... human adipose tissue-derived stromal cells after cerebral ischemia in rats. Exp Neurol 2003, 183:355-366. 20. Banas A, Teratani T, Yamamoto Y, Tokuhara M, Takeshita F, Osaki M, Kawamata M,...
Ngày tải lên : 18/06/2014, 16:20
  • 16
  • 488
  • 0
Báo cáo hóa học: " The Effects of Notch Filtering on Electrically Evoked Myoelectric Signals and Associated Motor Unit Index Estimates" ppt

Báo cáo hóa học: " The Effects of Notch Filtering on Electrically Evoked Myoelectric Signals and Associated Motor Unit Index Estimates" ppt

... spastic-paretic stroke survivors. J Neurophysiol 2009, 102:2026-2038. 42. Dattola R, Girlanda P, Vita G, Santoro M, Roberto ML, Toscano A, Venuto C, Baradello A, and Messina C: Muscle rearrangement ... Figure 1a illustrates, in addition to reduced amplitude and area of the first negative phase of the M wave, the M wave shape tends to change from two major phases to multiple p...
Ngày tải lên : 19/06/2014, 08:20
  • 34
  • 449
  • 0
Báo cáo hóa học: " High level expression of human epithelial β-defensins (hBD-1, 2 and 3) in papillomavirus induced lesions" ppt

Báo cáo hóa học: " High level expression of human epithelial β-defensins (hBD-1, 2 and 3) in papillomavirus induced lesions" ppt

... 5'-CTTCTGTTTGCTTTGCTCTTCC-3', antisense 5'-CCTCTGACTCTGCAATAATA-3'; HD5 sense 5'-ACCTCAGGTTCTCAGGCAAGAGC-3', antisense 5'-GACACAAGGTACACAGAGTAAAATGT-3'; HD6 sense 5'-GCTTTGGGCTCAACAAGGGCTTTC-3', antisense ... 5'-GCTTTGGGCTCAACAAGGGCTTTC-3', antisense 5'-GACACACGACAGTTTCCTTCTAGGTCATA- 3'; IL-8 sense TTGGCAGCCTTCCTGATTTC-...
Ngày tải lên : 20/06/2014, 01:20
  • 8
  • 439
  • 0
báo cáo hóa học:" Neutrophil elastase, an acid-independent serine protease, facilitates reovirus uncoating and infection in U937 promonocyte cells" pptx

báo cáo hóa học:" Neutrophil elastase, an acid-independent serine protease, facilitates reovirus uncoating and infection in U937 promonocyte cells" pptx

... Corcoran TW, de Garavilla L, Kauffman JA, Recacha R, Chattopadhyay D, Andrade-Gor- don P, Maryanoff BE: Nonpeptide inhibitors of cathepsin G: optimization of a novel beta-ketophosphonic acid lead ... experimental design and data analysis. J.W.G. also wrote the initial draft of the manuscript. L .A. S. is corre- sponding author, participated in experimental design, data analysis and cr...
Ngày tải lên : 20/06/2014, 04:20
  • 14
  • 310
  • 0

Xem thêm