báo cáo hóa học:" Research Article Fixed Point Results in Quasimetric Spaces Abdul Latif and Saleh A Al-Mezel" pdf
báo cáo hóa học:" Determinants of quality of life in adults with type 1 and type 2 diabetes" pdf
... Longitudinal Exercise and Diabetes Research Advancement (ALEXANDRA) study was a population-based, l ongitudinal study of physical activitydeterminants in adults with diabetes in Alberta, Canada.The ... between T1D and T2 D groups.Methods: The Alberta Longitudinal Exercise and Diabetes Research Advancement (AL EXANDRA) study, a longitudinal study of adults with diabetes in Alberta, Canada. Adults ... ron.plotnikoff@newcastle.edu.au2School of Education, University of Newcastle, Callaghan, (2308), AustraliaFull list of author information is available at the end of the article Imayama et al. Health and Quality...
- 9
- 500
- 0
Báo cáo hóa học: " Research Article Call Admission Control Jointly with Resource " doc
... 2008.[11] S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour,“Performance evaluation and analytical modeling of noveldynamic call admission control scheme for 3G and beyondcellular wireless ... desired than blocking a new prioritizedcall arrival, an amount of capacity C is re served as a guardchannel for only handoff prioritized call arrivals. New and handoff call arrivals to cellular system ... note that determination of handoff arrival ratedepends on the steady-state probability which is unknownat the begining. By setting the initial values for handoff callarrival rates and using the...
- 10
- 398
- 0
Báo cáo hóa học: " Some new fixed point theorems for set-valued contractions in complete metric spaces" doc
... doi:10.1016/0022-247X(89)90214-X5. Amini-Harandi, A: Fixed point theory for set-valued quasi-contraction maps in metric spaces. Appl Math Lett. 24(2),24–1794 (2011)6. Chatterjea, SK: Fixed point theorems. C.R Acad Bulgare ... fixed point in X. In the recent, Amini-Harandi [5] gave th e following fixed point theorem for set-valued quasi-contraction maps in metric spaces. Theorem 3 [5]Let (X, d) be a complete metric space. ... article as: Chen: Some new fixed point theorems for set-valued contractions in complete metric spaces. Fixed Point Theory and Applications 2011 2011:72.Submit your manuscript to a journal and...
- 8
- 311
- 0
Báo cáo toán học: " Nonlinear coupled fixed point theorems in ordered generalized metric spaces with integral type" potx
... point results in G-metric spaces. Int. J.Math. Anal. 2009 (ID 283028), 10 (2009)32. Shatanawi, W: Fixed point theory for contractive mappings satisfying Φ-maps in G-metric spaces. Fixed Point ... of mappings in ordered metric space are of great use in many mathematical problems in applied and pure mathematics. The first result in this direction was obtained by Ran and Reurings [1], in thisstudy, ... 241–1252 (2008)6. Bhaskar. TG, Lakshmikantham, V: Fixed point theorems in partially ordered metric spaces and appli-cations. Nonlinear Anal. 65 1379–1393 (2006)7. Lakshmikantham, V,´Ciri´c,...
- 22
- 295
- 0
Báo cáo hóa học: "Retention of progenitor cell phenotype in otospheres from guinea pig and mouse cochlea" ppt
... were sacrificed in a carbon dioxide chamber.Tissue isolation and dissociationAfter bathing the animals in absolute ethanol, they weredecapitated and had the temporal bones removed and maintained ... from guinea pig and mouse cochleaJeanne Oiticica1*, Luiz Carlos M Barboza-Junior1, Ana Carla Batissoco2, Karina Lezirovitz1,Regina C Mingroni-Netto2, Luciana A Haddad2, Ricardo F ... andOesterleshowedthroughautoradiographic techniques after tritiated thymidinelabeling that simultaneous infusion of TGFa and insulindirectly into the inner ear of adult rats stimulated DNAsynthesis...
- 10
- 476
- 1
Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx
... latter is the pre-requisite for obtaining meaningful data on a patient’sphysical status and may be particularly valuable for asses-sing a patient’s ability to perform occupational tasks and consequently ... enDynamics) and Stata Version 10.1(StatCorp LP, College Station, Texas, USA). Descriptiveanalyses of numerical parameters included mean, median,minimum and maximum, and distribution and standarddeviation. ... compared using paired t-tests (a = 0.005). In addition,variability in these parameters during one-minute intervals was examined. The fatigue index was defined as thenumber of significant mean and...
- 13
- 434
- 0
báo cáo hóa học:" Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors" potx
... recom-binant virus was propagated and titrated as described pre-viously [57]. vV5D4: primers5'ACTAGATACGTATAAAAAGGTATCTAATTTGATATAATGGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGAATTCAGTGACTGT3' ... recombinant virusesvGFP-lacI: the open reading frame that encodes GFP-lacIwas cloned by PCR using primers5'CAGGCTGCGCAACTGTTGGGAAGGGCGA3' and 5'AAAAGTACTAGCCTGGGGTGCCTAATGAGTGAGC3'with ... purposes)Intracellular localization of replicated plasmid containing tandem lacO repeats using a lacI-GFP fusion proteinFigure 4Intracellular localization of replicated plasmid containing tandem lacO repeats...
- 12
- 177
- 0
báo cáo hóa học:" ACL reconstruction with unicondylar replacement in knee with functional instability and osteoarthritis" pdf
... Procedure A straight anterior skin incision and medial parapatellarcapsular incision were used. Intravenous antibioticprophylaxis and antibiotic- loaded acrylic cement (Pala-cos with gentamicin) ... devascularisationof the medial third remaining. The one patient who had a hamstring graft was a carpet layer who used his knee tokick his carpet laying tool and it was felt that a patella pro-cedure ... preparation ofthe femoral and tibial surfaces first in the usual mannerfor unicompartmental arthroplasty. The tibial and femo-ral tunnels for the ACL graft were drilled in the same man-ner and...
- 5
- 425
- 0
báo cáo hóa học:" Enhancing the efficacy of cisplatin in ovarian cancer treatment – could arsenic have a role" potx
... platinum alone and with platinum-containing combinations [25].An additional class of drug, the taxanes, was discovered and came to play a role in the front-line armamentariumagainst EOC. In ... accumulation and increased drug inactivation by cellular protein and non-protein thiols whilst Group B includes increased plat-inum-DNA adduct repair and increased platinum-DNAdamage tolerance ... efficacy of cisplatin could have a major impact in the fight against this disease.Arsenite is an exciting agent that not only has inherent single-agent tumoricidal activity againstovarian cancer...
- 7
- 504
- 0
báo cáo hóa học:" Health-related quality of life in patients waiting for major joint replacement. A comparison between patients and population controls" pot
... the integrity of the work as a whole. Shecontributed as a principal researcher and writer includingdrafting the article and the analysis and interpretation ofdata. MB was the leader of the research ... Pekka Rissanen8 and Harri Sintonen2Address: 1National Research and Development Centre for Welfare and Health, Helsinki, Finland, 2University of Helsinki, Finland, 3Academy of Finland, ... Seitsalo - seppo.seitsalo@invalidisaatio.fi; Matti Lehto - matti.lehto@coxa.fi; Pekka Paavolainen - pekka.paavolainen@invalidisaatio.fi; Kalevi Hietaniemi - kalevi.hietaniemi@hus.fi; Pekka Rissanen...
- 7
- 447
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ