báo cáo hóa học:" Research Article Fixed Point Results in Quasimetric Spaces Abdul Latif and Saleh A Al-Mezel" pdf

... Longitudinal Exercise and Diabetes Research Advancement (ALEXANDRA) study was a population-based, l ongitudinal study of physical activity determinants in adults with diabetes in Alberta, Canada. The ... between T1D and T2 D groups. Methods: The Alberta Longitudinal Exercise and Diabetes Research Advancement (AL EXANDRA) study, a longitudinal study of adults with diabetes i...

Ngày tải lên: 20/06/2014, 15:20

... 2008. [11] S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour, “Performance evaluation and analytical modeling of novel dynamic call admission control scheme for 3G and beyond cellular wireless ... desired than blocking a new prioritized call arrival, an amount of capacity C is re served as a guard channel for only handoff prioritized call arrivals. New and handoff call arr...

Ngày tải lên: 20/06/2014, 22:20

... doi:10.1016/0022-247X(89)90214-X 5. Amini-Harandi, A: Fixed point theory for set-valued quasi-contraction maps in metric spaces. Appl Math Lett. 24(2), 24–1794 (2011) 6. Chatterjea, SK: Fixed point theorems. C.R Acad Bulgare ... fixed point in X. In the recent, Amini-Harandi [5] gave th e following fixed point theorem for set- valued quasi-contraction maps in metric...

Ngày tải lên: 20/06/2014, 22:20

... point results in G-metric spaces. Int. J. Math. Anal. 2009 (ID 283028), 10 (2009) 32. Shatanawi, W: Fixed point theory for contractive mappings satisfying Φ-maps in G-metric spaces. Fixed Point ... of mappings in ordered metric space are of great use in many mathematical problems in applied and pure mathematics. The first result in this direction was obtained by Ran...

Ngày tải lên: 20/06/2014, 20:20

... were sacrificed in a carbon dioxide chamber. Tissue isolation and dissociation After bathing the animals in absolute ethanol, they were decapitated and had the temporal bones removed and maintained ... from guinea pig and mouse cochlea Jeanne Oiticica 1* , Luiz Carlos M Barboza-Junior 1 , Ana Carla Batissoco 2 , Karina Lezirovitz 1 , Regina C Mingroni-Netto 2 , Luciana A Hadda...

Ngày tải lên: 18/06/2014, 16:20

... latter is the pre- requisite for obtaining meaningful data on a patient’s physical status and may be particularly valuable for asses- sing a patient’s ability to perform occupational tasks and consequently ... enDynamics) and Stata Version 10.1 (StatCorp LP, College Station, Texas, USA). Descriptive analyses of numerical parameters included mean, median, minimum and maximum, and...

Ngày tải lên: 19/06/2014, 08:20

... recom- binant virus was propagated and titrated as described pre- viously [57]. vV5D4: primers 5'ACTAGATACGTATAAAAAGGTATCTAATTTGATATAAT GGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATT CTACGAATTCAGTGACTGT3' ... recombinant viruses vGFP-lacI: the open reading frame that encodes GFP-lacI was cloned by PCR using primers 5'CAGGCTGCGCAACTGTTGGGAAGGGCGA3' and 5'AAAAGTACTAGCCTGGGG...

Ngày tải lên: 20/06/2014, 04:20

... Procedure A straight anterior skin incision and medial parapatellar capsular incision were used. Intravenous antibiotic prophylaxis and antibiotic- loaded acrylic cement (Pala- cos with gentamicin) ... devascularisation of the medial third remaining. The one patient who had a hamstring graft was a carpet layer who used his knee to kick his carpet laying tool and it was felt that...

Ngày tải lên: 20/06/2014, 04:20

... platinum alone and with platinum-containing combinations [25]. An additional class of drug, the taxanes, was discovered and came to play a role in the front-line armamentarium against EOC. In ... accumulation and increased drug inactivation by cellular protein and non-protein thiols whilst Group B includes increased plat- inum-DNA adduct repair and increased platinum-DNA damag...

Ngày tải lên: 20/06/2014, 07:20

... the integrity of the work as a whole. She contributed as a principal researcher and writer including drafting the article and the analysis and interpretation of data. MB was the leader of the research ... Pekka Rissanen 8 and Harri Sintonen 2 Address: 1 National Research and Development Centre for Welfare and Health, Helsinki, Finland, 2 University of Helsinki, Finla...

Ngày tải lên: 20/06/2014, 15:20