... upon the arrival of a new or handoff data calls, arriving data calls use the remaining bandwidth from the prioritized calls. This leads to available bandwidth usage of the data calls and better ... S. A. Alqahtani, A. S. Hassan Mahmoud, and A. Alshanyour, “Performance evaluation and analytical modeling of novel dynamic call admission control scheme for 3G and beyond cellular wir...
Ngày tải lên: 20/06/2014, 22:20
... LF: Balance NAVE: a virtual reality facility for research and rehabilitation of balance disorders. In In: Proceed- ings of the ACM symposium on virtual reality software and technology: 2001; Banff, ... DiZio and Lackner suggest that wearing an HMD effectively increases the mass and inertia of the head, thereby leading to a sen- sory rearrangement that may have some part in s...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf
... of primers were designed; pA12L- forward: 5'-CACTCCATGGATGGCGG ATAAAAAAAATT- TAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACAT- TCCCATATCCA GACAAC; p233-forward: 5'- ATGGCGGATAAAAAAAATTTAGCC ... 5'- ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'- TTA ATACATTCCCATATCCAGACAAAATTCG. In order to construct A1 2L with abrogated cleavage at an N-terminal AG /A site (AG /A...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Kaposi''''s sarcoma associated herpesvirus G-protein coupled receptor activation of cyclooxygenase-2 in vascular endothelial cells" ppt
... in real-time PCR analyses. MKO participated in experimental design and data interpreta- tion. CAM participated in experimental design, data inter- pretation and manuscript preparation. DES participated in ... participated in experimental design, data interpretation and manu- script preparation. All authors read and approved the final manuscript. Acknowledgements We thank Marvin Reit...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Human umbilical cord blood-derived mononuclear cell transplantation: case series of 30 subjects with Hereditary Ataxia" pdf
... Engineering Research Institution, Shenzhen, China 4 Medistem Inc, San Diego, CA, USA Full list of author information is available at the end of the article Yang et al. Journal of Translational ... physicians and therapists using BBS, a validated functional scale that measur es the ability to walk, balance while st anding and other activities of daily living for ataxia patients...
Ngày tải lên: 20/06/2014, 03:20
báo cáo hóa học:" Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain" pptx
... lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain. Journal of Orthopaedic Surgery and Research 2010 5:14. Submit your next manuscript to BioMed Central and take ... isointense to CSF) signal in the right greater than left facet joints, as well as diffusely increased signal in the adjacent paravertebral muscles. ( 2A and C) The midline sagittal MRI im...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" What works to meet the sexual and reproductive health needs of women living with HIV/AIDS" pdf
... Gutin S, Johri N, Subramaian L, Kakande H, Nagendi G, Randiki M, Masita-Mwangi M: Evaluation of a Family Planning and Antiretroviral Therapy Integration Pilot in Mbale, Uganda New York: The ACQUIRE ... during expanding access to antiretroviral therapy in Mbarara, Uganda. Am J Public Health 2009, 99(2):340-347. 25. Ssewankambo F, Naluga C, Namale G, Luatalo I, Kambugo A: Determina...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " A common fixed point theorem for a commuting family of nonexpansive mappings one of which is multivalued" pdf
... common fixed points of a pair of single valued and multivalued commuting mappings) to infinite number of mappings and to a wider class of spaces. 2000 Mathematics Subject Classification: 47H09; ... Correspondence: sompongd@chiangmai.ac.th 1 Department of Mathematics, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand Full list of author information is a...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf
... The use of both instruments in different populations, includ- ing clinical samples and from different geographical areas in Spain will allow for continuing the validation and interpretation strategies ... HRQL domains setting cut -of- points of adequate health. The applicability of HRQL measures for children and ado- lescents are similar for those in adult ages such as the i...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Tobacco smoke particles and indoor air quality (ToPIQ) - the protocol of a new study" potx
... ML, Pham L, McDermott A, Zeger SL, Samet JM: Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases. Jama-Journal of the American Medical Association ... Ruprecht A, De Marco C, Mazza R, Tagliapietra L, Michieletto F, Allegri F, Sbrogio L, Bettoncelli G, Sasco A, Boffi R: Smoking in car: monitoring pollution of particulate matter as ma...
Ngày tải lên: 20/06/2014, 00:20