Báo cáo hóa học: " Air ambulance services in the Arctic 1999-2009: a Norwegian study" pptx
Báo cáo hóa học: " Air ambulance services in the Arctic 1999-2009: a Norwegian study" pptx
... Seaso-nal variations are shown in Figure 3. Half of all frac-tures occurred in April and August. The male/femaleratio was 1.6 (inhabitants at Svalbard have a male/female ratio of 1.3). Fractures ... such a setting, Svalbard maybecome an important base for air ambulance services in the Arctic. Air ambulance service is costly and limited in terms ofresources, especially in the Arctic [17]. ... collected the data from the LABAS database and made overviews of the material. JNcarried out the statistical analysis, searched the PubMed database forrelevant studies/reports and wrote the article....
- 8
- 213
- 0
báo cáo hóa học: " Air ambulance flights in northern Norway 20022008. Increased number of secondary fixed wing (FW) operations and more use of rotor wing (RW) transports" pot
... dedi-cated air ambulance airplane located at Akureyri. In addition there are planes stationed in Westma n IslandsandÍsafjörður.Theseplanesaremannedonanadhocbasis. Furthermore the coast guard runs ... the data from the LABAS database and presented an overview of the material.JN carried out the statistical analysis, searched the PubMed database forrelevant studies/reports, and wrote the article. ... 4:55http://www.intjem.com/content/4/1/55Page 5 of 9employing descriptive statistics and one-way analysis ofvariance (ANOVA).We accessed anonymous annual data from each air ambulance location. We had no access to individualpatient...
- 9
- 243
- 0
báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx
... patients[41]. Finally, Type D was a strong predictor of adversecardiac outcome after acute myocardial infarction, and the associated risk was similar to that of traditio nal car-diovascular ... general psychological distress that affects mental andphysical health status and is associated with disease-promoting mechanisms and work-related problems in apparently healthy individuals.Introduction In ... nega-tive affectivity was related to dampened heart ratereactivity [11]. Type D was also associated with a differ-ential activity of the amygdala in react ion to fearful ver-sus neutral fa...
- 10
- 595
- 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
... clinic appointment books. A research assistant then mailed an informational letter to the child's parent to inform them about the study. Thosewho were interested in participating contacted ... ages 8–17 can talkabout and respond to items asking them about theirhealth and well-being. They can also offer unique insightinto the understandability of the items. These findings areconsistent ... Hill, North Carolina, USAEmail: Debra E Irwin* - dirwin@email.unc.edu; James W Varni - JVarni@archmail.tamu.edu; Karin Yeatts - Karin_Yeatts@unc.edu; Darren A DeWalt - darren_dewalt@med.unc.edu*...
- 10
- 480
- 1
báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc
... D: The metastatic niche: adapting the foreignsoil. Nat Rev Cancer 2009, 9:285-293.22. Hiraiwa K, Takeuchi H, Hasegawa H, Saikawa Y, Suda K, Ando T,Kumagai K, Irino T, Yoshikawa T, Matsuda S, ... different kind of cancer, but the available dataare scarce [18,19]. In a series of 26 gastric cancer patients,Survivin mRNA (as measured by means of ELISA-basedqrtPCR) in the peripheral blood has ... carcinoma cell line NCI-N87, obtainedfrom the American Type Culture Collection (Manassas,USA), was incubated in RPMI-1640 medium (Invitrogen -Gibco, Carlsbad, CA, USA) containing 10% fetal...
- 8
- 565
- 0
Báo cáo hóa học: " Endotoxin and CD14 in the progression of biliary atresia" ppt
... aspartateaminotransferase (AST) levels, and total bilirubin are sum-marized in Table 1. Informed consent was obtained from the patients or their legal guardians, and the experimentswere approved ... liver injury and impaired soluble CD14 synthesis in the latestages of BA.BackgroundBiliary atresia (BA) is a typical cholestatic neonatal dis-ease, characterized by obliteration of intra- and/orextra-hepatic ... withan increase in serum alanine aminotransferase (ALT)and bilirubin levels. As shown in Figure 6, ALTincreased to 1053 IU/L (BDL vs. sham; P = 0.001) atDay 1 after ligation, indicating severe...
- 14
- 472
- 0
Báo cáo hóa học: " Age-related differences in dual task walking: a cross sectional study" ppt
... evident in a patient who trainedunder a single task balance training program. Whethertraining under dual task conditions can improve gait orfall risk during dual task walking needs further investiga-tion.Interpreting ... gait performance rather thannatural variations that may occur in gait.An increase in variability from one stride to the next,whether the measure reflects variability in step length[33], variability ... In the dual task condition subjectsstarted counting backwards as they initiated their walkingtrials and continued the task until they terminated the trial. Ten walking trials under each condition...
- 8
- 302
- 0
báo cáo hóa học: " Involvement of β-chemokines in the development of inflammatory demyelination" ppt
... phosphoinositidine 3-kinase pathway, while the Gβγsubunits activate phospholipase C and induce Ca2+ influxand protein kinase C activation. The involvement of MAPkinases as well as JAK/STAT signaling also ... regulation of intercellular interac-tions in the peripheral lymphoid organs, at the BBB and in the CNS. In addition to defining chemotaxis, CCL-CCRinteractions are involved in TH1 / TH2 polarization ... recoveryrather than in the initiation of the disease. In addition,CCL19 and CCL21 are expressed by endothelial cells of the BBB, and are involved in the strengthening of leuko-cyte adhesion to inflamed...
- 14
- 421
- 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc
... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 betaReverse TGAGTCACAGAGGATGGGCTCIL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6Reverse AAGTGCATCATCGTTGTTCATACAIL-12 ... TGTACAGAGCTCCACGGCTGCiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivatorReverse ACGCCAGTCTGACGAAGGTCCACOX-2 Forward CAGACAACATAAACTGCGCCTT ... BTH, andWFH participated in the design and assisted with the preparation of the manuscript. All authors have read and approved the final version of the manuscript.Competing interests The authors...
- 8
- 447
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ