Báo cáo hóa học: " Air ambulance services in the Arctic 1999-2009: a Norwegian study" pptx

... Seaso- nal variations are shown in Figure 3. Half of all frac- tures occurred in April and August. The male/female ratio was 1.6 (inhabitants at Svalbard have a male/ female ratio of 1.3). Fractures ... such a setting, Svalbard may become an important base for air ambulance services in the Arctic. Air ambulance service is costly and limited in terms of resources, es...

Ngày tải lên: 21/06/2014, 07:20

... dedi- cated air ambulance airplane located at Akureyri. In addition there are planes stationed in Westma n Islands andÍsafjörður.Theseplanesaremannedonanadhoc basis. Furthermore the coast guard runs ... the data from the LABAS database and presented an overview of the material. JN carried out the statistical analysis, searched the PubMed database for relevant studies/repor...

Ngày tải lên: 21/06/2014, 00:20

... patients [41]. Finally, Type D was a strong predictor of adverse cardiac outcome after acute myocardial infarction, and the associated risk was similar to that of traditio nal car- diovascular ... general psychological distress that affects mental and physical health status and is associated with disease-promoting mechanisms and work-related problems in apparently healthy individuals. I...

Ngày tải lên: 18/06/2014, 19:20

... clinic appointment books. A research assistant then mailed an informational letter to the child's parent to inform them about the study. Those who were interested in participating contacted ... ages 8–17 can talk about and respond to items asking them about their health and well-being. They can also offer unique insight into the understandability of the items. These findings...

Ngày tải lên: 18/06/2014, 19:20

... D: The metastatic niche: adapting the foreign soil. Nat Rev Cancer 2009, 9:285-293. 22. Hiraiwa K, Takeuchi H, Hasegawa H, Saikawa Y, Suda K, Ando T, Kumagai K, Irino T, Yoshikawa T, Matsuda S, ... different kind of cancer, but the available data are scarce [18,19]. In a series of 26 gastric cancer patients, Survivin mRNA (as measured by means of ELISA-based qrtPCR) in the perip...

Ngày tải lên: 18/06/2014, 15:20

... aspartate aminotransferase (AST) levels, and total bilirubin are sum- marized in Table 1. Informed consent was obtained from the patients or their legal guardians, and the experiments were approved ... liver injury and impaired soluble CD14 synthesis in the late stages of BA. Background Biliary atresia (BA) is a typical cholestatic neonatal dis- ease, characterized by obliteration...

Ngày tải lên: 18/06/2014, 16:20

... evident in a patient who trained under a single task balance training program. Whether training under dual task conditions can improve gait or fall risk during dual task walking needs further investiga- tion. Interpreting ... gait performance rather than natural variations that may occur in gait. An increase in variability from one stride to the next, whether the measure reflect...

Ngày tải lên: 19/06/2014, 08:20

... phosphoinositidine 3-kinase pathway, while the Gβγ subunits activate phospholipase C and induce Ca 2+ influx and protein kinase C activation. The involvement of MAP kinases as well as JAK/STAT signaling also ... regulation of intercellular interac- tions in the peripheral lymphoid organs, at the BBB and in the CNS. In addition to defining chemotaxis, CCL-CCR interactions are...

Ngày tải lên: 19/06/2014, 22:20

Ngày tải lên: 19/06/2014, 22:20

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...

Ngày tải lên: 19/06/2014, 22:20