Báo cáo hóa học: " Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a " docx
Báo cáo hóa học: " Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a " docx
... pagesdoi:10.1155/2011/639043 Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a High-Throughput AreaEfficient Systolic Array Implementation of DCTDoru Florin Chiper and Paul ... implementation thatis well adapted for a VLSI realization. Thus, a new memory-based VLSI systolic array with a high-throughput and a substantially reduced hardware complexity can be obtained.AcknowledgmentsThe ... It can be used to obtainan efficient VLSI architecture using a linear memory-basedsystolic array. The proposed algorithm and its associated VLSI architecture have good numerical properties that...
- 14
- 331
- 0
Báo cáo hóa học: " Research Article Novel Data Fusion Method and Exploration of Multiple Information Sources for " ppt
... (C)TATAAA (A) , TACAAAT, TTAAA,ATAAATA, TTAAAT, TATAAGTCF1 1 GTTATTGGTTAAAGAAGTATA,GTGTAGGTTACTTATTCTCCTTTTGTTGATEAD1 2 (AA)CATTCCTT(CGG), AGGAGGAATGTGCTRP53 2 GAGCAAGTCA, ATACAAGGCCEURASIP ... ACCCAAATATGGCT, CCTTACATGG,CCAAGAATGG, CCAAATAAGG,GCCCATGTAAGGAG, GAAACGCCATATAAGGAGCAGG,GCAGCGCCTTATATGGAGTGGC, CTCCAAATTTAGGC,TGCTTCCCATATATGGCCATGT, CCATATTAGG, CTATTATGGTBP 1 (C)TATAAA (A) , ... AGATAG, TGAGATTACAHNF3 1 AAGTCAATAATC (A) , TTTGTGTAGGTTAIPF1 1 TCTAATMEF1 2 CCCCCCAACACCTGCTGCCTGAGCCMEF2C 1 CTATAAATACMYB 2 GAACGT, ACGTTAMYF5 2 2 [25, 26] CCCAACACCTGCTGCCTGAGCC, CATCTG, CAGTTGMYOD1...
- 15
- 332
- 0
Báo cáo hóa học: " Research Article Novel Techniques of Single-Carrier Frequency-Domain Equalization for Optical Wireless Communications" doc
... 3 with size M×N.Foracomplexnumbera, Re (a) andIm (a) represent the real and imaginary part of a, respectively ;for an N×1vectorA, [A( k)]N−1k=0 [A( 0), A( 1), , A( N −1)]T and A ∗is the vector ... cannot directlybe applied to DOW with IM/DD. This is because thetransmitted signal has to be real and positive while basebandSCFDE signals are generally complex and bipolar. In fact,ACO and ... performance has the worstperformance and reliable communication cannot happen ascanbeseeninFigures14 to 17. This is again due the fact that for the larger constellation size, the PAPR of ACO-OFDM...
- 13
- 367
- 0
Báo cáo hóa học: " Research Article Novel Approaches to Enhance Mobile WiMAX Security" pdf
... Standard for Local and Metropolitan Area NetworksPart 16: Air Interface for Fixed Broadband Wireless AccessSystems, Amendment 2: Physical and Medium Access ControlLayers for Combined Fixed and ... rewritten, and themain approach was also revised with coherence.References[1] “IEEE Standard for Local and Metropolitan Area NetworksPart 16: Air Interface for Fixed Broadband Wireless AccessSystems,” ... Wireless Access Standards released IEEE 802.16-2004 which is a standardizedtechnology for supporting broadband and wireless communication with fixed and nomadic access. After the IEEE 802.16-2004standard,...
- 11
- 290
- 0
Báo cáo hóa học: "Research Article µ-Stability of Impulsive Neural Networks with Unbounded Time-Varying Delays and Continuously Distributed Delays" doc
... may cause instability and poor performance of practical systems. Therefore, the stabilityanalysis for neural networks with time-delay has attracted a large amount of research interest, and many ... negative semidefinitematrix. The notations A T and A −1mean the transpose of A and the inverse of a squarematrix. λmax A or λmin A denote the maximum eigenvalue or the minimum eigenvalueof ... 1988.2 M. A. Cohen and S. Grossberg, “Absolute stability of global pattern formation and parallel memorystorage by competitive neural networks,” IEEE Transactions on Systems, Man, and Cybernetics,...
- 12
- 364
- 0
Báo cáo hóa học: " Research Article Systems of Quasilinear Parabolic Equations with Discontinuous Coefficients and Continuous Delays" docx
... Equations 2511 O. A. Ladyzhenskaya and N. N. Ural’ceva, Linear and Quasilinear Elliptic Equations, Academic Press,New York, NY, USA, 1968.12 O. A. Ladyˇzenskaja, V. Ja. Rivkind, and ... Sibirski˘ı Matematiˇceski˘ıˇZurnal, vol. 4, pp. 1071–1105, 1963 Russian.10 O. A. Ladyzenskaya, V. A. Solonnikov, and N. N. Ural’ceva, Linear and Quasilinear Equations of ParabolicType, American ... of Mathematical Analysis and Applications, vol. 196, no. 1, pp. 237–265, 1995.5 J. Liang, H Y. Wang, and T J. Xiao, “On a comparison principle for delay coupled systems with nonlocal and nonlinear...
- 25
- 348
- 0
Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx
... T. Thayaparan, L. J. Stankovic, C. Wernik, and M. Dakovic,“Real-time motion compensation, image formation and image enhancement of moving targets in ISAR and SAR usingS-method-based approach,” ... Wong, and E.Riseborough, “Application of adaptive joint time-frequency algorithm for focusing distorted ISAR images from simulated and measured radar data,” IEE Proceedings: Radar, Sonar and Navigation, ... and Z. Bao, “Experimen-tal research of unsupervised Cameron/maximum-likelihoodclassification method for fully polarimetric synthetic apertureradar data,” IEE Proceedings Radar, Sonar and Navigation,...
- 9
- 412
- 0
Báo cáo hóa học: " Research Article Binary Biometric Representation through Pairwise Adaptive Phase Quantization Chun Chen and Raymond Veldhuis" ppt
... Quantization and coding is thestraightforward way to extract binary representations from arbitrary real-valued biomet ric modalities. In this paper, we propose a pairwise adaptive phase quantization (APQ) ... financed byTechnology Foundation STW, the Netherlands Organization for Scientific Research (NWO), and the Dutch Ministry ofEconomic A airs.References[1] A. K. Jain, K. Nandakumar, and A. Nagar, ... 237–257, 2006.[5] K. Nandakumar, A. K. Jain, and S. Pankanti, “Fingerprint-based fuzzy vault: implementation and performance,” IEEETransactions on Information Forensics and Security, vol. 2,...
- 16
- 232
- 0
Báo cáo hóa học: " Research Article Existence of Solutions to Anti-Periodic Boundary Value Problem for Nonlinear Fractional " potx
... T. Maraaba, D. Baleanu, and F. Jarad, “Existence and uniqueness theorem for a class of delaydifferential equations with left and right Caputo fractional derivatives,” Journal of MathematicalPhysics, ... Article ID 083507, 11 pages, 2008.18 T. A. Maraaba, F. Jarad, and D. Baleanu, “On the existence and the uniqueness theorem for fractionaldifferential equations with bounded delay within Caputo ... time-varying generating operators in Banach spaces,” Opuscula Mathematica,vol.30,no.3,pp.361–381, 2010.20 A. A. Kilbas, H. M. Srivastava, and J. J. Trujillo, Theory and Applications of Fractional...
- 17
- 416
- 0
Báo cáo hóa học: " Research Article Variational-Like Inclusions and Resolvent Equations Involving Infinite Family of Set-Valued Mappings" pdf
... Theory and Applications 137 X. P. Ding and C. L. Luo, “Perturbed proximal point algorithms for general quasi-variational-likeinclusions,” Journal of Computational and Applied Mathematics, ... spaces,” Applied Mathematics and Computation,vol. 163, no. 1, pp. 295–308, 2005.2 R. Ahmad and Q. H. Ansari, “An iterative a lgorithm for generalized nonlinear variational inclusions,”Applied Mathematics ... 153–165, 2000.8 Ram U. Verma, “On generalized variational inequalities involving relaxed Lipschitz and relaxedmonotone operators,” Journal of Mathematical Analysis and Applications, vol. 213,...
- 13
- 267
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfhoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcbáo cáo y họcbáo cáo môn họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)