Báo cáo hóa học: " Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a " docx
... pages doi:10.1155/2011/639043 Research Article Novel VLSI Algorithm and Architecture with Good Quantization Properties for a High-Throughput Area Efficient Systolic Array Implementation of DCT Doru Florin Chiper and Paul ... implementation that is well adapted for a VLSI realization. Thus, a new memory- based VLSI systolic array with a high-throughput...
Ngày tải lên: 21/06/2014, 07:20
... (C)TATAAA (A) , TACAAAT, TTAAA, ATAAATA, TTAAAT, TATAAG TCF1 1 GTTATTGGTTAAAGAAGTATA, GTGTAGGTTACTTATTCTCCTTTTGTTGA TEAD1 2 (AA)CATTCCTT(CGG), AGGAGGAATGTGC TRP53 2 GAGCAAGTCA, ATACAAGGCC EURASIP ... ACCCAAATATGGCT, CCTTACATGG, CCAAGAATGG, CCAAATAAGG, GCCCATGTAAGGAG, GAAACGCCATATAAGGAGCAGG, GCAGCGCCTTATATGGAGTGGC, CTCCAAATTTAGGC, TGCTTCCCATATATGGCCATGT, CCATATTAGG, CTATTATGG TBP 1 (C)TATAAA (...
Ngày tải lên: 21/06/2014, 08:20
... 3 with size M ×N.Foracomplexnumbera, R e (a) andI m (a) represent the real and imaginary part of a, respectively ;for an N ×1vectorA, [A( k)] N−1 k =0 [A( 0), A( 1), , A( N −1)] T and A ∗ is the vector ... cannot directly be applied to DOW with IM/DD. This is because the transmitted signal has to be real and positive while baseband SCFDE signals are generally complex and...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: " Research Article Novel Approaches to Enhance Mobile WiMAX Security" pdf
... Standard for Local and Metropolitan Area Networks Part 16: Air Interface for Fixed Broadband Wireless Access Systems, Amendment 2: Physical and Medium Access Control Layers for Combined Fixed and ... rewritten, and the main approach was also revised with coherence. References [1] “IEEE Standard for Local and Metropolitan Area Networks Part 16: Air Interface for Fixed Bro...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: "Research Article µ-Stability of Impulsive Neural Networks with Unbounded Time-Varying Delays and Continuously Distributed Delays" doc
... may cause instability and poor performance of practical systems. Therefore, the stability analysis for neural networks with time-delay has attracted a large amount of research interest, and many ... negative semidefinite matrix. The notations A T and A −1 mean the transpose of A and the inverse of a square matrix. λ max A or λ min A denote the maximum eigenvalue or th...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Systems of Quasilinear Parabolic Equations with Discontinuous Coefficients and Continuous Delays" docx
... Equations 25 11 O. A. Ladyzhenskaya and N. N. Ural’ceva, Linear and Quasilinear Elliptic Equations, Academic Press, New York, NY, USA, 1968. 12 O. A. Lady ˇ zenskaja, V. Ja. Rivkind, and ... Sibirski ˘ ı Matemati ˇ ceski ˘ ı ˇ Zurnal, vol. 4, pp. 1071–1105, 1963 Russian. 10 O. A. Ladyzenskaya, V. A. Solonnikov, and N. N. Ural’ceva, Linear and Quasilinear Equations of Par...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx
... T. Thayaparan, L. J. Stankovic, C. Wernik, and M. Dakovic, “Real-time motion compensation, image formation and image enhancement of moving targets in ISAR and SAR using S-method-based approach,” ... Wong, and E. Riseborough, “Application of adaptive joint time-frequency algorithm for focusing distorted ISAR images from simulated and measured radar data,” IEE Proceedings: Radar,...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Binary Biometric Representation through Pairwise Adaptive Phase Quantization Chun Chen and Raymond Veldhuis" ppt
... Quantization and coding is the straightforward way to extract binary representations from arbitrary real-valued biomet ric modalities. In this paper, we propose a pairwise adaptive phase quantization (APQ) ... financed by Technology Foundation STW, the Netherlands Organization for Scientific Research (NWO), and the Dutch Ministry of Economic A airs. References [1] A. K. Jain, K....
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Existence of Solutions to Anti-Periodic Boundary Value Problem for Nonlinear Fractional " potx
... T. Maraaba, D. Baleanu, and F. Jarad, “Existence and uniqueness theorem for a class of delay differential equations with left and right Caputo fractional derivatives,” Journal of Mathematical Physics, ... Article ID 083507, 11 pages, 2008. 18 T. A. Maraaba, F. Jarad, and D. Baleanu, “On the existence and the uniqueness theorem for fractional differential equations with...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article Variational-Like Inclusions and Resolvent Equations Involving Infinite Family of Set-Valued Mappings" pdf
... Theory and Applications 13 7 X. P. Ding and C. L. Luo, “Perturbed proximal point algorithms for general quasi-variational-like inclusions,” Journal of Computational and Applied Mathematics, ... spaces,” Applied Mathematics and Computation, vol. 163, no. 1, pp. 295–308, 2005. 2 R. Ahmad and Q. H. Ansari, “An iterative a lgorithm for generalized nonlinear variational inclusi...
Ngày tải lên: 21/06/2014, 07:20