Báo cáo hóa học: " Negative pressure characteristics of an evaporating meniscus at nanoscale" pptx

... 6:72 http://www.nanoscalereslett.com/content/6/1/72 Page 3 of 7 NANO EXPRESS Open Access Negative pressure characteristics of an evaporating meniscus at nanoscale Shalabh C Maroo 1,2* , JN Chung 1 Abstract This study aims at understanding the characteristics ... extended meniscus. Int J Heat Mass Transfer 1972, 15:1851. 9. Maroo SC, Chung JN: Heat transfer characterist...

Ngày tải lên: 21/06/2014, 06:20

Ngày tải lên: 18/06/2014, 18:20

... concentrations produce a different pat- tern of response to that of the PT in that there is a prolif- erative response at 10 -8 M but an inhibition of cell number at higher doses. At present we can ... preparation of manuscript; CGR: sourcing of human tissue, preparation of manuscript; AS: planning of experiments, some experimental work, preparation of manuscript. Ack...

Ngày tải lên: 20/06/2014, 01:20

... the lateral side of the ankle in 1 case, and of the dorsum of the foot in 12 cases. All patients had at least one tendon or bone exposed at the initiation of NPWT, and four had an associated infection ... design, patient recruitment and follow-up, data collection and analysis, and manu- script writing. JWK carried out literature search and data analysis. WKM carried out data col...

Ngày tải lên: 20/06/2014, 01:20

... vibration at 1,650 cm −1 , and the spectra exhibit an absorption peak for decreasing the C-H stretching vibration at 2,900 cm −1 and the C-H bending vibration at 1,400 cm −1 in the case of ... plays an important role in attaching the DNA onto the substrate through a strong electrostatic interaction between the amine groups of the sample surface and the negatively charged p...

Ngày tải lên: 20/06/2014, 23:20

... RESULTS AND ANALYSIS 4.1. Measured MIMO-OFDM channels Figure 3 shows an example of measured MIMO-OFDM channels. Sets of MIMO-OFDM channels obtained at eight 8 EURASIP Journal on Wireless Communications ... NLoS 2 and LoS 2 paths are shown in Figure 5.The spread of points indicates that some pairs of MIMO subchan- nels are more correlated than others. It is apparent that the magnit...

Ngày tải lên: 22/06/2014, 22:20

... were generated by a panel of clinicians and researchers based on quantitative and qualitative work with carers and reviewed by a panel of "expert carers" [12,16,26,27]. The panel was ... treat- ment, and the scales of EDSIS, ECI -negative and GHQ-12 were low, and most were non significant. Significant cor- relations were found between type of diagnosis and Dys- Table 2: Fac...

Ngày tải lên: 18/06/2014, 22:20

... the investigation of the genetic determinants of its virulence. This clone will also allow the rapid, rational development and testing of candidate live attenuated vaccines and antiviral therapeutics ... introduction/priming cDNA synthesis from negative- strand RNA P8 CCTATTGCAGACATGATTGACCAG none RT-PCR for negative- strand RNA P9 TGTTGTTATCTTGTCTCTACTAGTG none RT-PCR for neg...

Ngày tải lên: 20/06/2014, 01:20

... assessment of outcomes in cancer anemia and fatigue. Semin Hemtol 1997, 34(Suppl2):13-19. 2. Vogelzang N, et al: Patient, caregiver, and oncologist perceptions of cancer-related fatigue: results of a ... Table 2. Translation issues The EORTC Quality of Life Department Translation Office translated the item list into the languages of the participating centres. Researchers at the pa...

Ngày tải lên: 20/06/2014, 15:20

... Institute of Mathematics, Seoul National University. Author details 1 Department of Mathematics, Hanyang University, Seoul 133-791, Republic of Korea 2 Department of Mathematics, University of Ulsan, ... Ulsan 680-749, Republic of Korea 3 Department of Mathematics, Daejin University, Kyeonggi 487- 711, Republic of Korea 4 Department of Mathematics, University of Seoul, Seo...

Ngày tải lên: 21/06/2014, 01:20