Báo cáo hóa học: " Exertional heat stroke in a marathon runner with extensive healed deep burns: a case report" ppt
Báo cáo hóa học: " Exertional heat stroke in a marathon runner with extensive healed deep burns: a case report" ppt
... herbody surface area able to dissipate heat by perspirationand vasodilation. This was probably not enough to main-tain normothermia during her marathon endeavour.Some investigators have pointed ... ofthermoregulatory impairment in patients with healed burns. Ann PlastSurg 1978, 1(2):172-6.doi:10.1186/1865-1380-4-12Cite this article as: Seth and Juliana: Exertional heat stroke in a marathon runner ... evening of the same day. She was eventuallydischarged with advice to refrain from participating in anysuch endurance events because of her singular physiology.DiscussionHeatstroke is traditionally...
- 3
- 220
- 0
báo cáo hóa học: " Negligible heat strain in armored vehicle officers wearing personal body armor" pptx
... mid-shift samples. In thesecases, the average USG was taken as the mid-shift value.Eight AVOs had USG data at all time points, and wereused in statistical analysis.Data are summarized as mean and ... higher,and sweat evaporation was lower when wearing the PBA[8]. Again it was concluded that the moderately higher heat strain was likely due to reductions in evaporative heat loss.Taken together, ... Standardisation: ISO 9886: Ergonomics -Evaluation of thermal strain by physiological measurements. Geneva:International Organisation for Standardisation; 2004.25. International Organisation for Standardisation:...
- 6
- 257
- 0
báo cáo hóa học:" GJB2 mutation spectrum in 2063 Chinese patients with nonsyndromic hearing impairment" pptx
... C-terminal ion channel domain. Replacing thehydrophobic amino acid isoleucine with a hydrophilicamino acid asparagine in this conserved region is expectedto cause detrimental effect. This variant ... PCR amplified with forward primer5'TTGGTGTTTGCTCAGGAAGA 3' and reverse primer5'GGCCTACAGGGGTTTCAAAT 3'. Among this studycohort, 851 patients from central China were also ana-lyzed ... province), Yin-chuan School for the Blind, Deaf and Dumb (Ningxia Province), Xining Spe-cial Education School (Qinghai province), Changan School for the Deaf and Dumb (Shaanxi province), Affiliated...
- 12
- 507
- 0
báo cáo hóa học: " Quality of life in caregivers of patients with schizophrenia: A literature review" ppt
... Claudia Miranda-Castillo - c.miranda@ucl.ac.uk* Corresponding author AbstractBackground: A couple of decades ago, hospitals or psychiatric institutions were in charge ofcaring for patients with ... similarities werefound in the results obtained from the studies reviewed: a) What variables are related to QOL damage in caregiversof patients with schizophrenia?Main variable was emotional ... 2008, 158:335-343.34. Hanzawa S, Tanaka G, Inadomi H, Urata M, Ohta Y: Burden anddoping strategies in mothers of patients with schizophrenia in Japan. Psychiatry Clin Neurosci 2008, 62:256-263.35....
- 5
- 506
- 1
báo cáo hóa học: " Quality of life in chemical warfare survivors with ophthalmologic injuries: the first results form Iran Chemical Warfare Victims Health Assessment Study" potx
... civilians and veterans) of theIran-Iraq war are given a severity index (disability rate) in the Veterans and Martyrs Affair Foundation (VMAF) data-base, based on their clinical problems and severity ... manuscript.AcknowledgementsJanbazan Medical and Engineering Research Center (JMERC), and Veterans and Martyrs Affair Foundation (VMAF) funded the study.References1. Zargar M, Araghizadeh H, Soroush MR, Khaji A: Iranian ... Tehran has became a multicultural metropolitan areait has been suggested that a sample from the general pop-ulation in Tehran at least could be regarded as a represent-ative sample of urban...
- 8
- 383
- 0
Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf
... theEmma Children's Hospital/Academic Medical CenterAmsterdam is a tertiary PICU with 14 beds admittingpatients from the greater Amsterdam area. Medical, surgi-cal and trauma patients and patients ... Alamgir AH, Anis AH, Fitzgerald MJ, Marra CA:Evaluating health-related quality-of-life studies in paediatricpopulations: some conceptual, methodological and develop-mental considerations and ... phys-ical aspect that is evaluated and social aspects, familyfunctioning, and well being are not evaluated. In a fifthstudy the Royal Alexandra Hospital for Children (RAHC)Table 4: TACQOL-CF...
- 9
- 440
- 0
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx
... molecules, including CSPGsand tenascin, are important participants in the wound-healing process. They are expressed at low levels in thenormal brain and are induced by injury. In a damagedbrain, ... Immunohistochemical localization of interleukin-1beta,interleukin-1 receptor antagonist and interleukin-1beta con-verting enzyme/caspase-1 in the rat brain after peripheraladministration of kainic acid. Neuroscience ... injury, we analyzed the expression of two glutamatetransporters, glutamate aspartate transporter (GLAST) andglutamate transporter-1 (GLT-1/EAAT2), the glutamatetransaminase, glutamine synthetase...
- 11
- 402
- 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc
... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 betaReverse TGAGTCACAGAGGATGGGCTCIL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6Reverse AAGTGCATCATCGTTGTTCATACAIL-12 ... TGTACAGAGCTCCACGGCTGCiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivatorReverse ACGCCAGTCTGACGAAGGTCCACOX-2 Forward CAGACAACATAAACTGCGCCTT ... NM_011198.3 prostaglandin-endoperoxide synthase 2 (Ptgs2)Reverse GATACACCTCTCCACCAATGACCIL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin 1 alphaReverse TCCTTCAGCAACACGGGCTGGTIL-1b...
- 8
- 447
- 0
Báo cáo hóa học: " SIV escape mutants in rhesus macaques vaccinated with NEF-derived lipopeptides and challenged with pathogenic SIVmac251" docx
... Kobayashi M, Igarashi H, Takeda A, Nakamura H, Kano M,Sugimoto C, Mori K, Iida A, Hirata T, Hasegawa M, Yuasa T, MiyazawaM, Takahashi Y, Yasunami M, Kimura A, O'Connor DH, Watkins DI,Nagai ... also. As for macaque109 that lacked detectable cell-associated viremia, viralDNA integrated in PBMC was identified and sequenced. A single viral variant was detected in this latter animalwithin ... Dobratz E, Markham PD, Hel Z, Nacsa J, Klein M,Tartaglia J, Franchini G: ALVAC-SIV-gag-pol-env-based vaccina-tion and macaque major histocompatibility complex class I (A* 01) delay simian immunodeficiency...
- 12
- 325
- 0
báo cáo hóa học:" Proximal screws placement in intertrochanteric fractures treated with external fixation: comparison of two different techniques" pdf
... was measured in bothgroups.Postoperative ManagementEvaluation during treatment included plain radiographsand pain assessment using the visual anal og scale (VAS).Clinical evaluation of patients ... encouraged. The patients were advisedto do partial weight-bearing depending on tolerance topain. Weight-bearing was gradually increase d and fullweight-bearing was allowed when clinica l and radiologi-cal ... statistical analysis. AEB, INKA, and AVK participated in itsdesign and coordination and helped to draft the manuscript MDV has hadthe main responsibility for the study and manuscript preparation. All...
- 7
- 234
- 0
Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ