Báo cáo hóa học: " Exertional heat stroke in a marathon runner with extensive healed deep burns: a case report" ppt

... her body surface area able to dissipate heat by perspiration and vasodilation. This was probably not enough to main- tain normothermia during her marathon endeavour. Some investigators have pointed ... of thermoregulatory impairment in patients with healed burns. Ann Plast Surg 1978, 1(2):172-6. doi:10.1186/1865-1380-4-12 Cite this article as: Seth and Juliana: Exertional heat...

Ngày tải lên: 21/06/2014, 05:20

... mid-shift samples. In these cases, the average USG was taken as the mid-shift value. Eight AVOs had USG data at all time points, and were used in statistical analysis. Data are summarized as mean and ... higher, and sweat evaporation was lower when wearing the PBA [8]. Again it was concluded that the moderately higher heat strain was likely due to reductions in evaporative heat loss...

Ngày tải lên: 20/06/2014, 00:20

... C-terminal ion channel domain. Replacing the hydrophobic amino acid isoleucine with a hydrophilic amino acid asparagine in this conserved region is expected to cause detrimental effect. This variant ... PCR amplified with forward primer 5'TTGGTGTTTGCTCAGGAAGA 3' and reverse primer 5'GGCCTACAGGGGTTTCAAAT 3'. Among this study cohort, 851 patients from central China w...

Ngày tải lên: 18/06/2014, 15:20

... Claudia Miranda-Castillo - c.miranda@ucl.ac.uk * Corresponding author Abstract Background: A couple of decades ago, hospitals or psychiatric institutions were in charge of caring for patients with ... similarities were found in the results obtained from the studies reviewed: a) What variables are related to QOL damage in caregivers of patients with schizophrenia? Main variable...

Ngày tải lên: 18/06/2014, 19:20

... civilians and veterans) of the Iran-Iraq war are given a severity index (disability rate) in the Veterans and Martyrs Affair Foundation (VMAF) data- base, based on their clinical problems and severity ... manuscript. Acknowledgements Janbazan Medical and Engineering Research Center (JMERC), and Veterans and Martyrs Affair Foundation (VMAF) funded the study. References 1. Zargar M, Araghi...

Ngày tải lên: 18/06/2014, 19:20

... the Emma Children's Hospital/Academic Medical Center Amsterdam is a tertiary PICU with 14 beds admitting patients from the greater Amsterdam area. Medical, surgi- cal and trauma patients and patients ... Alamgir AH, Anis AH, Fitzgerald MJ, Marra CA: Evaluating health-related quality-of-life studies in paediatric populations: some conceptual, methodological and develop- mental consi...

Ngày tải lên: 18/06/2014, 22:20

... molecules, including CSPGs and tenascin, are important participants in the wound- healing process. They are expressed at low levels in the normal brain and are induced by injury. In a damaged brain, ... Immunohistochemical localization of interleukin-1beta, interleukin-1 receptor antagonist and interleukin-1beta con- verting enzyme/caspase-1 in the rat brain after peripheral adminis...

Ngày tải lên: 19/06/2014, 22:20

... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGTTGTTCATACA IL-12 ... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACA...

Ngày tải lên: 19/06/2014, 22:20

... Kobayashi M, Igarashi H, Takeda A, Nakamura H, Kano M, Sugimoto C, Mori K, Iida A, Hirata T, Hasegawa M, Yuasa T, Miyazawa M, Takahashi Y, Yasunami M, Kimura A, O'Connor DH, Watkins DI, Nagai ... also. As for macaque 109 that lacked detectable cell-associated viremia, viral DNA integrated in PBMC was identified and sequenced. A single viral variant was detected in this latter an...

Ngày tải lên: 20/06/2014, 01:20

... was measured in both groups. Postoperative Management Evaluation during treatment included plain radiographs and pain assessment using the visual anal og scale (VAS). Clinical evaluation of patients ... encouraged. The patients were advised to do partial weight-bearing depending on tolerance to pain. Weight-bearing was gradually increase d and full weight-bearing was allowed when clinica l...

Ngày tải lên: 20/06/2014, 07:20