Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx
Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx
... nanostructures. Scr Mater 2008, 58:854-857.
doi:10.1186/1556-276X-6-272
Cite this article as: Wang et al.: ZnSe nanotrenches: formation
mechanism and its role as a 1D template. Nanoscale Research ... 6:272
http://www.nanoscalereslett.com/content/6/1/272
Page 6 of 6
NANO EXPRESS Open Access
ZnSe nanotrenches: formation mechanism and its
role as a 1D templat...
Báo cáo hóa học: " Time-Frequency Signal Synthesis and Its Application in Multimedia Watermark Detection" potx
... polynomial-phase signals. The phase of many man-made
signals such as those used in radar, sonar, communications
can be modeled as a polynomial. The discrete version of a
polynomial-phase signal can ... w hales, and bats),
whistling sound, as well as in man-made systems such as in
radar, sonar, telecommunications, physics, and acoustics. For
example, in radar applications, ch...
Báo cáo hóa học: " Investigation of Nucleation Mechanism and Tapering Observed in ZnO Nanowire Growth by Carbothermal Reduction Technique" ppt
... (Ka)at0.524keV,Au
(Ma)at2.1keV,andZn(La)at3.4keVusinga20kV
electron beam. The data obtained shows that the island
(point A) has a greater concentration of Zn compared
to Au. With increasing amount of ... ellipsoidal/triangular kind of
shape, whereas the straight nanowire still maintains a
hemispherical particle shape. It appears that the catalyst
in the tapered wire is elongated along th...
báo cáo hóa học: "Psychological wellbeing, physical impairments and rural aging in a developing country setting" potx
... Thammasat University, Pathumthani, Thailand
Email: Melanie A Abas* - m.abas@iop.kcl.ac.uk; Sureeporn Punpuing - prspu@mahidol.ac.th;
Tawanchai Jirapramupitak - tawanchaij@gmail.com; Kanchana ... wellbeing.
Chance is an unlikely explanation for the adjusted associ-
ation between paralysis and low wellbeing, and for the
adjusted association between disability and low wellbe-
ing, as...
báo cáo hóa học: " Biomarkers of oxidative stress and its association with the urinary reducing capacity in bus maintenance workers" pptx
... have demonstrated that
incr eased levels of airborne particles are associated with
adverse health effects, such as cancer, cardiovascular
and pulmonary diseases [1]. Among the different
mechanisms ... evaluated and interpreted the data, prepared and
participated in the manuscript writing. PW: evaluated the data, performed
the statistical analysis and participated in the writing of t...
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf
... ATAAAAAAAATT-
TAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACAT-
TCCCATATCCA GACAAC; p233-forward: 5'-
ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'-
TTA ATACATTCCCATATCCAGACAAAATTCG. ... sequences at the residues
55–57 (underlined), 5'-
CTTAATTCTCAAACAGATGTGACTATCGACATC
TGTGA-
TACAAAATCAAAGAGTTCA-3'. The AG /A site-mutated
A1 2L was inserted in pRB21 vector.
For...
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc
... source of glutamate is N-acetyl-aspartyl-glutamate (NAAG) which is hydrolyzed to glutamate and
N-acetyl-aspartate (NAA) in a reaction catalyzed by glutamate carboxypeptidase (GCP). As a result, GCP ... of
‘high affinity’ glutamate transporters GLT1, GLAST, EAAC1 and of GCPII
in the rat peripheral nervous system. J Anat 2008, 213:539-546.
6. Cassidy M, Neale JH: N-acetylaspartylgluta...
báo cáo hóa học:" Comparing two intramedullary devices for treating trochanteric fractures: A prospective study" potx
... to the Evan’s
classification as modified by Jensen [9,10]. T hirty seven
fractures was graded as stable and 73 as unstable for the
IMHS while 39 as stable and 66 as unstable fractures
for the ... prospective
study
Konstantinos G Makridis
*
, Vasileios Georgaklis, Miltiadis Georgoussis, Vasileios Mandalos, Vasileios Kontogeorgakos,
Leonidas Badras
Abstract
Background: Intertrocha...
báo cáo hóa học: " Assessment of psychosocial functioning and its risk factors in children with pectus excavatum" ppt
... socio-demographic variables, patients’ medical and psychological characteristics. The severity of
malformation was assessed by CT scan. For comparison, an age- and gender- match ed control group was recruited
from ... The aim of this study was to assess the severity of psychosocial
problems as associated with PE, as well as to identify its risk factors.
Methods: A comparative st...
báo cáo hóa học:" Psychological wellbeing, physical impairments and rural aging in a developing country setting" docx
... Population and Social Research,
Mahidol University, Nakhonpathom, Thailand and
3
Faculty of Medicine, Thammasat University, Pathumthani, Thailand
Email: Melanie A Abas* - m.abas@iop.kcl.ac.uk; ... setting
Melanie A Abas*
†1
, Sureeporn Punpuing
†2
, Tawanchai Jirapramupitak
†3
,
Kanchana Tangchonlatip
†2
and Morven Leese
†1
Address:
1
Health Service and Population Research De...