Báo cáo hóa học: "ZnSe nanotrenches: formation mechanism and its role as a 1D template" potx

... nanostructures. Scr Mater 2008, 58:854-857. doi:10.1186/1556-276X-6-272 Cite this article as: Wang et al.: ZnSe nanotrenches: formation mechanism and its role as a 1D template. Nanoscale Research ... 6:272 http://www.nanoscalereslett.com/content/6/1/272 Page 6 of 6 NANO EXPRESS Open Access ZnSe nanotrenches: formation mechanism and its role as a 1D templat...

Ngày tải lên: 21/06/2014, 04:20

... polynomial-phase signals. The phase of many man-made signals such as those used in radar, sonar, communications can be modeled as a polynomial. The discrete version of a polynomial-phase signal can ... w hales, and bats), whistling sound, as well as in man-made systems such as in radar, sonar, telecommunications, physics, and acoustics. For example, in radar applications, ch...

Ngày tải lên: 22/06/2014, 23:20

... (Ka)at0.524keV,Au (Ma)at2.1keV,andZn(La)at3.4keVusinga20kV electron beam. The data obtained shows that the island (point A) has a greater concentration of Zn compared to Au. With increasing amount of ... ellipsoidal/triangular kind of shape, whereas the straight nanowire still maintains a hemispherical particle shape. It appears that the catalyst in the tapered wire is elongated along th...

Ngày tải lên: 21/06/2014, 08:20

... Thammasat University, Pathumthani, Thailand Email: Melanie A Abas* - m.abas@iop.kcl.ac.uk; Sureeporn Punpuing - prspu@mahidol.ac.th; Tawanchai Jirapramupitak - tawanchaij@gmail.com; Kanchana ... wellbeing. Chance is an unlikely explanation for the adjusted associ- ation between paralysis and low wellbeing, and for the adjusted association between disability and low wellbe- ing, as...

Ngày tải lên: 18/06/2014, 19:20

... have demonstrated that incr eased levels of airborne particles are associated with adverse health effects, such as cancer, cardiovascular and pulmonary diseases [1]. Among the different mechanisms ... evaluated and interpreted the data, prepared and participated in the manuscript writing. PW: evaluated the data, performed the statistical analysis and participated in the writing of t...

Ngày tải lên: 20/06/2014, 00:20

... ATAAAAAAAATT- TAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACAT- TCCCATATCCA GACAAC; p233-forward: 5'- ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'- TTA ATACATTCCCATATCCAGACAAAATTCG. ... sequences at the residues 55–57 (underlined), 5'- CTTAATTCTCAAACAGATGTGACTATCGACATC TGTGA- TACAAAATCAAAGAGTTCA-3'. The AG /A site-mutated A1 2L was inserted in pRB21 vector. For...

Ngày tải lên: 20/06/2014, 01:20

... source of glutamate is N-acetyl-aspartyl-glutamate (NAAG) which is hydrolyzed to glutamate and N-acetyl-aspartate (NAA) in a reaction catalyzed by glutamate carboxypeptidase (GCP). As a result, GCP ... of ‘high affinity’ glutamate transporters GLT1, GLAST, EAAC1 and of GCPII in the rat peripheral nervous system. J Anat 2008, 213:539-546. 6. Cassidy M, Neale JH: N-acetylaspartylgluta...

Ngày tải lên: 20/06/2014, 03:20

... to the Evan’s classification as modified by Jensen [9,10]. T hirty seven fractures was graded as stable and 73 as unstable for the IMHS while 39 as stable and 66 as unstable fractures for the ... prospective study Konstantinos G Makridis * , Vasileios Georgaklis, Miltiadis Georgoussis, Vasileios Mandalos, Vasileios Kontogeorgakos, Leonidas Badras Abstract Background: Intertrocha...

Ngày tải lên: 20/06/2014, 04:20

... socio-demographic variables, patients’ medical and psychological characteristics. The severity of malformation was assessed by CT scan. For comparison, an age- and gender- match ed control group was recruited from ... The aim of this study was to assess the severity of psychosocial problems as associated with PE, as well as to identify its risk factors. Methods: A comparative st...

Ngày tải lên: 20/06/2014, 15:20

... Population and Social Research, Mahidol University, Nakhonpathom, Thailand and 3 Faculty of Medicine, Thammasat University, Pathumthani, Thailand Email: Melanie A Abas* - m.abas@iop.kcl.ac.uk; ... setting Melanie A Abas* †1 , Sureeporn Punpuing †2 , Tawanchai Jirapramupitak †3 , Kanchana Tangchonlatip †2 and Morven Leese †1 Address: 1 Health Service and Population Research De...

Ngày tải lên: 20/06/2014, 16:20