Báo cáo hóa học: " Advancing donor management research: design and implementation of a large, randomized, placebo-controlled trial" pot
báo cáo hóa học: " The Locomotor Capabilities Index; validity and reliability of the Swedish version in adults with lower limb amputation" ppt
... BL and IA performed the statistical analysis. BL and AJ drafted thepaper and IA critically revised it for important intellectualcontent. All authors read and gave approval of the finalmanuscript.Additional ... interestsThe authors declare that they have no competing interests.Authors' contributionsBL, HIA, AJ and IA conceived of and designed the study.BL, AJ and IA analyzed and interpreted the data. AJ, ... properties" and considered " ;a sample size of at least 50 patients adequate for the assess-ment of the agreement parameter, based on a generalguideline by Altman [31]" and an ICC of 0.70 as...
- 9
- 597
- 0
Báo cáo hóa học: " Associations between disease severity, coping and dimensions of health-related quality of life in patients admitted for elective coronary angiography – a cross sectional study" pdf
... statistical analysis and in drafting the manuscript, ON coordinated the study atthe hospital and participated in data collection, and indrafting the manuscript, BRH and AKW participated inplanning and ... biologicalvariables and the patient's perceived symptoms (Table 3).As shown in this table, we found a significant and appre-ciable association between angiographically confirmedCAD and self-reported ... ventricular ejection fraction; AFS: Angina Frequency Scale; CCS: Canadian Cardiovascular Society classification; NYHA: New York Heart Association; HADS: Hospital Anxiety and Depression Scale; ECS:...
- 12
- 463
- 0
báo cáo hóa học: " Managing variability in the summary and comparison of gait data" pot
... averages [41] may alsoamplify the apparent variability in gait data.Clinical significance of variabilityThe magnitude of variability and its alteration bears sig-nificant clinical value, having been ... demonstrated that typical location and spread estimators used in quantitative gait data anal-ysis, i.e. mean and variance, are highly susceptible tosmall quantities of contaminant data [48]. ... topic of univariate gait variables, robustestimation is proposed as a means of coping with contaminated gait data, and the summary of non-normally distributed gait data is demonstrated by way of...
- 20
- 552
- 0
báo cáo hóa học:" Percutaneous endoscopic lumbar discectomy: clinical and quality of life outcomes with a minimum 2 year follow-up" doc
... in NASS and VAS scores at 6months and 2 years postoperation compared to preopera-tion. Thus back pain and neurogenic symptoms are partic-ularly disabling and are associated with significantmorbidity ... and Pain Visual Analogue Scale (VAS) and returnto work.Results: The mean age was 35.6 years, the mean operative time was 55.8 minutes and the meanlength of follow-up was 3.4 years. The mean ... introduced at the safe triangle of Kambin,[2] the risk of nerve damage was low. We did not have anyneurological deficit in all the patients done under generalanesthesia. The advantage of general anesthesia...
- 8
- 583
- 0
Báo cáo hóa học: " Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes" potx
... TGTGCCGCTAGAGGTGAAATT 60 1.86As 18S Rev GCAAATGCTTTCGCTTTCGAs ISG15 Fwd CTGAAAAACGAAAAGGGCCA 100 1.83As ISG15 Rev GCAGGGACTCCCTCCTTGTTAs STAT1 Fwd TGTCTGTTGGCTCAGTTGCG 100 1.82As STAT1 Rev GAAATTGATGCTGTGGCGTCTAs ... theNBISA01 haemagglutinations in the present study, thelevel of IFN-α appeared to have a transient biphasic peakat 1 and 3 days post-haemagglutination.Both the UV- and heat-inactivated preparations ... Symposium on Aquatic Animal Health, California USA 2006.7. Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH: Character-ization of infectious salmon anemia virus, an orthomyxo-likevirus isolated...
- 12
- 391
- 0
Báo cáo hóa học: " Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance" doc
... GGTACCAAGCTTTCAGCTATGTCTTCCCCTGCCTCTCCATNP 5' NP bac TTTCAGAATTCAGTGCCTCAAAGGAAATAAAATCCTTTTTGTGGACACAATCTTTGAGGAGGGAATTATCTGGTTACNP 3' NP bac GGTACCAAGCTTTCAGTTACAGAACGACTCTAGGTGTCGATGTNote. ... TTTCAGAATTCGGATCCACCAGTCTTTATAAAGGGGTTTATGP1 3' GP1 bac GGTACCAAGCTTTCAGTCATAGCAATCTTCTACTAATATAAATATCTCTGP2 5' GP2 bac TTTCAGAATTCGGATCCGGCACATTCACATGGACACTGGP2 3' GP2 bac GGTACCAAGCTTTCAGCTATGTCTTCCCCTGCCTCTCCATNP ... augustgoba@yahoo.com; Darryl B Sampey - dsampey@biofactura.com; Philip J Ferro - philip.ferro@amedd.army.mil; Kathleen A Cashman - kathleen.cashman@amedd.army.mil; Randal J Schoepp - randal.schoepp@amedd.army.mil;...
- 14
- 411
- 0
báo cáo hóa học:" Combination therapy: the next opportunity and challenge of medicine" potx
... information is available at the end of the articleAscierto and Marincola Journal of Translational Medicine 2011, 9:115http://www.translational-medicine.com/content/9/1/115© 2011 Ascierto and Mari ... Shannon K,Harrigan PR, Hogg RS, Daly P, Kendall P: Association of highly activeantiretroviral therapy coverage, population viral load, and yearly newHIV diagnoses in British Columbia, Canada: ... O R I A L Open AccessCombination therapy: the next opportunity and challenge of medicinePaolo A Ascierto1* and Francesco M Marincola2AbstractFrom an historical point of view, combination...
- 3
- 338
- 0
báo cáo hóa học:"Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" docx
... represents an analyticalchallenge as there is no general analytical strategy availa-ble that is capable of identifying membrane and core pro-teins, low and high abundant proteins equally well.Therefore, ... sequences in FASTA format were organ-ized and loaded onto the in-house Mascot primarysequence database. All MS data was also searched againstthe MSDB database, a composite, non-identical proteinsequence ... Demkowicz WE, Maa JS, Esteban M: Identification and character-ization of vaccinia virus genes encoding proteins that arehighly antigenic in animals and are immunodominant in vac-cinated humans. J...
- 16
- 455
- 0
báo cáo hóa học:" Measuring outcomes in allergic rhinitis: psychometric characteristics of a Spanish version of the congestion quantifier seven-item test (CQ7)" pdf
... Barcleona, Spain; Michael Herdman, Lola Sanz,Josep-Mar a Manresa, Insight Consulting & Research, Barcelona, Spain; Mar a José Rosales, Medical Affairs, Schering-Plough, Madrid, Spain; VanesaGonzález, ... Hospital Vall de Hebrón, Barcelona, Spain; RamonaSoler, Allergology Department, Hospital Son Dureta, Palma de Mallor ca,Spain; Mª Teresa Audicana, Allergy Service, Hospital de Santiago, Vitoria,Spain; ... Spain.Cultural adaptation and validation studyThe CQ7 was adapted into Spanish for Spain following a process of cultural adaptation based on internationalrecommendations, which included translation...
- 5
- 361
- 0
Báo cáo hóa học: " Graphitic carbon growth on crystalline and amorphous oxide substrates using molecular beam epitaxy" pot
... SiO2 )and0 .089nm(onEagle2000™ glass).Notably,theR a of NCG on Eagle 2000™glass is almost the same as that of the substrate itselfwhich is famous for surface flatness.Figure 3 Raman spectra of ... degree of crys-tallinity is formed on SiO2. The Raman spectra are simi-lar to the best data from NCG on sapphire [8]: thesharp and large D peak and the clear 2D peak. Notably,the existence of ... es of graphitic carbon.1μm×1μm AFM images of graphitic carbon on (a) SiO2 and (b) Eagle 2000™ glass. The meanroughness parameters, R a , from 1 μm×1μm scans are (a) 0.224 nm and (b) 0.089 nm,...
- 6
- 320
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015