báo cáo hóa học: " Efficient reengineering of meso-scale topologies for functional networks in biomedical applications Andreas A Schuppert" pptx

báo cáo hóa học: " Efficient reengineering of meso-scale topologies for functional networks in biomedical applications Andreas A Schuppert" pptx

báo cáo hóa học: " Efficient reengineering of meso-scale topologies for functional networks in biomedical applications Andreas A Schuppert" pptx

... computational performance. Combinatorial stimulation-inhibition analysis using a direct functional reengineer- ing approach can aid in rapidly unravelling stable information about the coarse- grained ... describe a d irect approach for reengineering of the structure of hierar- chical functional networks. Hierarchical functional networks allow the establishment of mode...

Ngày tải lên: 21/06/2014, 02:20

20 322 0
Báo cáo hóa học: "Efficient Realization of Sigma-Delta (Σ-Δ) Kalman Lowpass Filter in Hardware Using FPGA" ppt

Báo cáo hóa học: "Efficient Realization of Sigma-Delta (Σ-Δ) Kalman Lowpass Filter in Hardware Using FPGA" ppt

... 1–11 DOI 10.1155/ASP/2006/52736 Efficient Realization of Sigma-Delta (Σ-Δ) Kalman Lowpass Filter in Hardware Using FPGA Saman S. Abeysekera and Charayaphan Charoensak School of Elect rical & Electronic ... Peter Handel Sigma-delta (Σ-Δ) modulation techniques h ave moved into mainstream applications in signal processing and have found many practical uses in areas such as high-...

Ngày tải lên: 22/06/2014, 23:20

11 250 0
Báo cáo hóa học: " Efficient Implementation of Complex Modulated Filter Banks Using Cosine and Sine Modulated Filter Banks" pot

Báo cáo hóa học: " Efficient Implementation of Complex Modulated Filter Banks Using Cosine and Sine Modulated Filter Banks" pot

... communications signal processing, complex-valued in- phase/quadrature (I/Q) sig- nals are commonly used. I/Q signals are obtained in a natural way when the baseband equivalent of a (modulated) band- pass ... signals are real- valued [2, 3]. In this way, main aliasing terms are missing and both magnitude and phase information is available. The desired filter bank properties depend hi...

Ngày tải lên: 22/06/2014, 23:20

10 301 0
báo cáo hóa học: "Whole-body isometric force/torque measurements for functional assessment in neuro-rehabilitation: platform design, development and verification" pot

báo cáo hóa học: "Whole-body isometric force/torque measurements for functional assessment in neuro-rehabilitation: platform design, development and verification" pot

... ADL tasks All data, after having been collected, are uploaded to a local database. The graphical user interface (Figure 8) Table 2: The values of anatomical angles in Position 1, Position 2 and ... period of data acquisition in clinical trials it was necessary to measure a large number of patients with the same device and in the same anatomical starting position. The data acqu...

Ngày tải lên: 19/06/2014, 08:20

15 372 0
Báo cáo hóa học: " Efficient Sequence Detection of Multicarrier Transmissions over Doubly Dispersive Channels" pdf

Báo cáo hóa học: " Efficient Sequence Detection of Multicarrier Transmissions over Doubly Dispersive Channels" pdf

... Foundation CAREER Award, and in 2005, the OSU College of Engineering Lumley Research Award. His areas of research include signal processing and communication theory. 6 EURASIP Journal on Applied Signal ... sequence estimate, is kept as a reference. The DFS algorithm then backs up one level at a time, reexam- ining the discarded branches at each level and pursuing any that have a c...

Ngày tải lên: 22/06/2014, 23:20

17 215 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al. (2004) STAT3 is constitutively activated and supports cell survival in association ... lines: inhibition of JAK3 ⁄ STAT3 signaling induces apoptosis and cell cycle arrest of colon carcinoma cells. Am J Pathol 167, 969–980. 27 Kunnumakkara AB, Anand P & Aggarwa...

Ngày tải lên: 18/02/2014, 08:20

11 558 0
Báo cáo khoa học: Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc

Báo cáo khoa học: Efficient inhibition of b-secretase gene expression in HEK293 cells by tRNAVal-driven and CTE-helicase associated hammerhead ribozymes doc

... toward cleavage of the GUC 665 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTGCCCTGCCCCCTGATGAGGCCGA AAGGCCGAAACTTGCCCCTGGTACCCCGGATAT CTTTTTTTCTATCGCGTCGACCT-3¢ and the template encoding ... template encoding Rz-2 (targeted toward CUC 825 containing sequence) is 5¢-CGGTTCGAAACCGGGCACTACAAA AACCAACTTTCACCCTTCCGCTGATGAGGCCGA AAGGCCGAAAGGTCCCGGTGGTACCCCGGATA TCTTTTTTTCTATCGCGT...

Ngày tải lên: 08/03/2014, 08:20

9 434 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

... constructed by ampli- fying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢- CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the ... proteins that contain the heavy chain and light chain variable domains (V H and V L , respectively) of an antibody connected by a linker [7]. Each domain has an intradomain disulfide bond....

Ngày tải lên: 16/03/2014, 23:20

7 331 0
Báo cáo khoa học: "Efficient Inference of CRFs for Large-Scale Natural Language Data" docx

Báo cáo khoa học: "Efficient Inference of CRFs for Large-Scale Natural Language Data" docx

... 1). In all learning curves, Dense gener- ally has a higher training log-likelihood than Sparse. For PTB and Encyclopedia, results for Dense are not available because training in a single machine ... Sutton, and A. McCallum. 2006. Sparse forward- backward using minimum divergence beams for fast train- ing of conditional random fields. In Proc. ICASSP. F. Sha and F. Pereira. 2...

Ngày tải lên: 23/03/2014, 17:20

4 400 0
Báo cáo hóa học: "Efficient Design Methods for Embedded Communication Systems" docx

Báo cáo hóa học: "Efficient Design Methods for Embedded Communication Systems" docx

... on either an analytical (static) or statistical (dynamic) approach. Each of these approaches has its benefits and drawbacks. 4.1. Analytical approaches All the analytical approaches to automate the ... starting from a directed acyclic graph (DAG). The objective function incorporates several constraints on available silicon area (hardware capacity), memory (software capacity), and latency a...

Ngày tải lên: 22/06/2014, 22:20

18 349 0
w