Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... descent method for common solutions of generalized mixed equilibrium problems and fixed point problems Nawitcha Onjai-uea 1,3 , Chaichana Jaiboon 2,3* and Poom Kumam 1,3 * Correspondence: chaichana. j@rmutr.ac.th 2 Department ... chaichana. j@rmutr.ac.th 2 Department of Mathematics, Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin...
Ngày tải lên: 21/06/2014, 01:20
... P. Katchang and P. Kumam, A general iterative method of fixed points for mixed equilibrium problems and variational inclusion problems, ” Journal of Inequalities and Applications, vol. 2010, Article ID ... Projection Method for Common Solutions of Generalized Mixed Equilibrium Problems and Fixed Point Problems for Strictly Pseudocontractive Map...
Ngày tải lên: 21/06/2014, 05:20
... Nonlinear Functional Analysis and Its Applications. III: Variational Methods and Opti- mization, Springer, New York, NY, USA, 1985. [11] I. Yamada, “The hybrid steepest- descent method for variational ... The- ory and Applications, vol. 79, no. 1, pp. 197–206, 1993. [7] Y. Yao and M. A. Noor, “On modified hybrid steepest- descent methods for general variational inequal...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx
... Surface area of the catalyst before and after use in the reaction was mea- sured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments). All the chemicals were used as-received. 5. ... they are cheap in general, commercially available, air stable crystalline solids, safe, and non-toxic, hence easy to handle. Results: Carbonyl compounds (aliphatic, heterocycl...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article Hybrid Viscosity Iterative Method for Fixed Point, Variational Inequality and Equilibrium Problem" pot
... “Viscosity approximation methods for nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol. 298, no. 1, pp. 279–291, 2004. 9 P. L. Combettes and S. A. Hirstoaga, Equilibrium ... and W. Takahashi, “Viscosity approximation methods for equilibrium problems and fixed point problems in Hilbert spaces,” Journal of Mathematical Analysis and Appli...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx
... effective- ness of the method for diameter measurement. The method is automated, accurate, and much faster than manual method and has the capability of being used as an on-line technique for quality control. References 1. ... The method was tested by a simulated image with known characteristics and a real web. Mean (M) and standard deviation (STD) of fiber diamete...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" ppt
... automated, accurate, and much faster than manual method and has the capability of being used as an on-line technique for quality control. References 1. A. K. Haghi, M. Akbari, Phys. Stat. Sol. A 204, ... paper, a new image analysis based method for electrospun nanofiber diameter measurement has been presented. The method was tested by a simulated image with known charact...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo hóa học: " A Novel Speech/Noise Discrimination Method for Embedded ASR System" pot
... rate Model-based Filter-based (c) 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 00.20.40.60.81 Probability of error I Correct rate Model-based Filter-based (d) Figure 2: Comparison of ROC curves of two methods in each dataset. APPENDIX DERIVATION OF FORMULA (3) For a Gaussian distribution p(x) ... σ 2 n+1 and µ n , σ 2 n are the mean vector and variance vector after and before upd...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo hóa học: " An implicit iterative algorithm with errors for two families of generalized asymptotically nonexpansive mappings" pptx
... , Agarwal et al. Fixed Point Theory and Applications 2011, 2011:58 http://www.fixedpointtheoryandapplications.com/content/2011/1/58 Page 8 of 17 Author details 1 Department of Mathematics, Texas ... Plubtieng et al. [14], Qin et al. [15], Thakur [ 21], Thianwan and Suantai [22], Xu and Ori [23], and Zhou and Chang [24] as special cases mainly improves the resul ts of Cia...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al. ... (’5to3’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaa...
Ngày tải lên: 18/06/2014, 16:20