Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific ... Open Access A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA Wang Yu-Hong 1† , Chen Rui 2† and...
Ngày tải lên: 21/06/2014, 01:20
... Sivasundaram, and B. Kaymakcalan, Dynamic Systems on Measure Chains, vol. 370 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, 1996. 15 L. Erbe, A. Peterson, ... p-Laplacian dynamic equations on time scales,” Journal of Mathematical Analysis and Applications, vol. 321, no. 2, pp. 911–920, 2006. 13 Y. Tian and W. Ge, “Existence an...
Ngày tải lên: 21/06/2014, 20:20
... 3D and 2D surfaces. The evaluation criteria for a particular classification procedure was chosen to be the classification rate of such stripe patterns. 3. TEXTURAL AND ADAPTED FEATURE SETS The main ... defined along the u-horizontal and the v-vertical image axes were used for the computation of the feature vectors based on the Fourier analysis. The characterized...
Ngày tải lên: 22/06/2014, 01:20
báo cáo hóa học: " A prototype power assist wheelchair that provides for obstacle detection and avoidance for those with visual impairments" pptx
... the advantages of tradi- tional manual wheelchairs. In a search of the literature, only one other smart wheel- chair was identified that was based on a manual wheel- chair. The Collaborative Wheelchair ... disadvantages when compared with manual wheelchairs. In general, manual wheelchairs are lighter and more maneuverable than power wheelchairs, and can be transported in a...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx
... considered as Neural activations of both the shoulder and the elbow mus-cle pairFigure 6 Neural activations of both the shoulder and the elbow mus- cle pair. Tall is the total time of neural activations, ... between the starting point and the arrival point: where the numerator is the length of the j-th trajectory (composed of H points) and the denominat...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Tobacco smoke particles and indoor air quality (ToPIQ) - the protocol of a new study" potx
... ML, Pham L, McDermott A, Zeger SL, Samet JM: Fine particulate air pollution and hospital admission for cardiovascular and respiratory diseases. Jama-Journal of the American Medical Association ... to the conception and design of the review, acquisition of the review data and have been involved in drafting and revising the manuscript. All authors have read and...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Treatment combining RU486 and Ad5IL-12 vector attenuates the growth of experimentally formed prostate tumors and induces changes in the sentinel lymph nodes of mice" doc
... Institute for Molecular Studies (TPIMS), 3550 General Atomics Court, San Diego, CA 92121, USA Full list of author information is available at the end of the article Gabaglia et al. Journal of Translational ... obtained from the Jackson Laboratory (Bar Harbor, MD) and bred in the animal facilities at TPIMS. All work was done according to TPIMS guidelines for animal use and...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "A new low-complexity angular spread estimator in the presence of line-of-sight with angular distribution selection" pptx
... i and the antenna-element k; and (a) Two antenna elements of an antenna array at the base station. (b) The V-array: an antenna array with 3 antenna elements at the base station. (c) An antenna ... that the base station ant enna-element s are isotropic and that the same mean AoA and AS are seen at all antenna-elements of the base station. We consider the estimation...
Ngày tải lên: 20/06/2014, 22:20