... proposed for the mechanism of antitumour action of BS-RNase is based on the ability of the protein to resist the neutralizing action of the cytosolic RNase inhibitor, a resistance due to the dimeric ... sulfhydryls. These results indicate that the intersubunit disulfide bonds of BS-RNase have a key role in the mechanism of antitumour action of the enzyme...
Ngày tải lên: 20/02/2014, 11:20
... contain pointers to the different forms belonging to their para- digm, and information relevant to all forms of a para- digm: e.g. case frames and semantic information). The corresponding ... responsible for computing the regular paradigm, which analyses this information and transfers control to an object computing forms of verbs belonging to a particular category of...
Ngày tải lên: 24/03/2014, 05:21
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were washed and incubated in the presence of an horseradish peroxidase ... carried out the in vitro and in vivo experiments, performed data analysis, and drafted the manuscript. VSC participated in the performance of the in viv...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" A model for extending antiretroviral care beyond the rural health centre" docx
... provided final approval to the manuscript. HMS assisted in data analysis, interpretation of results, and provided final approval of the manuscript. RV assisted in data collection, data analysis, interpretation ... assess- ment and insights gained from the clinic staff. Being in charge of the HIV clinic, the clinical officer had substantial experience in conducting perf...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " A note on the complete convergence for sequences of pairwise NQD random variables" potx
... contributions HH, DW and QW carried out the design of the study and performed the analysis. QZ participated in its design and coordination. All authors read and approved the final manuscript. Competing interests The ... NQD random variable sequences. We can refer to Matula [3] for the Kolmogo rov strong law of large num- bers, Wang et al. [4] for the Marcinkiewicz stro...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... protection for data processing operations at the data-parity level. Data processing implementations are protected against Figure 9 Average MSE values versus standard deviation. Hamidi et al. EURASIP ... Design evaluation The m ethods discussed in this article are programmed using the MATLAB programming tool. The MATLAB codeformsthebasisforasimulationprogramthat explores the role...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " A note on the complete convergence for arrays of dependent random variables" docx
... for arrays of dependent rand om variables. Journal of Inequalities and Applications 2011 2011:76. Sung Journal of Inequalities and Applications 2011, 2011:76 http://www.journalofinequalitiesandapplications.com/content/2011/1/76 Page ... EX ni I(|X ni |≤δ)) > . (2:21) TherestoftheproofissameasthatofTheorem1.6exceptusingTheorem2.6 instead of Theorem 2.4 and is omitted....
Ngày tải lên: 20/06/2014, 22:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC VK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Program for the Machine Translation of Natural Languages" pdf
... information-retaining cells. The information retained by any particular group of cells at any one time may be called the state of this part of the automaton. The state of the entire automa- ton ... with a more abstract turn of mind, it is sometimes called an abstract automaton. Abstract automata, at least the kind we are interested in, can be thought of as a...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt
... application for the formalism presented here lies in the domain of machine translation. The transfer model of MT may be thought of as involving three dis- tinct mappings; from the source language ... its interpretation, outline two alternative rule application regimes, and illus- trate the use of the formalism in the areas of machine translation and reduct...
Ngày tải lên: 01/04/2014, 00:20