báo cáo hóa học: " A protocol for the emergency department management of acute undifferentiated febrile illness in India" potx
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
... proposed for the mechanism of antitumour
action of BS-RNase is based on the ability of the protein
to resist the neutralizing action of the cytosolic RNase
inhibitor, a resistance due to the dimeric ... sulfhydryls.
These results indicate that the intersubunit disulfide bonds
of BS-RNase have a key role in the mechanism of
antitumour action of the enzyme...
Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf
... contain
pointers to the different forms belonging to their para-
digm, and information relevant to all forms of a para-
digm: e.g. case frames and semantic information). The
corresponding ... responsible for computing the regular
paradigm, which analyses this information and transfers
control to an object computing forms of verbs belonging
to a particular category of...
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... Cambridge, MA), STING (Abcam, Cambridge,
MA) or a mouse monoclonal antibody against gG1
(Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were
washed and incubated in the presence of an horseradish
peroxidase ... carried out the
in vitro and in vivo experiments, performed data analysis, and drafted the
manuscript. VSC participated in the performance of the in viv...
báo cáo hóa học:" A model for extending antiretroviral care beyond the rural health centre" docx
... provided final approval to the manuscript.
HMS assisted in data analysis, interpretation of results,
and provided final approval of the manuscript. RV
assisted in data collection, data analysis, interpretation ... assess-
ment and insights gained from the clinic staff. Being in
charge of the HIV clinic, the clinical officer had substantial
experience in conducting perf...
Báo cáo hóa học: " A note on the complete convergence for sequences of pairwise NQD random variables" potx
... contributions
HH, DW and QW carried out the design of the study and performed the analysis. QZ participated in its design and
coordination. All authors read and approved the final manuscript.
Competing interests
The ... NQD random variable
sequences. We can refer to Matula [3] for the Kolmogo rov strong law of large num-
bers, Wang et al. [4] for the Marcinkiewicz stro...
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... protection
for data processing operations at the data-parity level.
Data processing implementations are protected against
Figure 9 Average MSE values versus standard deviation.
Hamidi et al. EURASIP ... Design evaluation
The m ethods discussed in this article are programmed
using the MATLAB programming tool. The MATLAB
codeformsthebasisforasimulationprogramthat
explores the role...
Báo cáo hóa học: " A note on the complete convergence for arrays of dependent random variables" docx
... for arrays of dependent rand om variables.
Journal of Inequalities and Applications 2011 2011:76.
Sung Journal of Inequalities and Applications 2011, 2011:76
http://www.journalofinequalitiesandapplications.com/content/2011/1/76
Page ... EX
ni
I(|X
ni
|≤δ))
>
.
(2:21)
TherestoftheproofissameasthatofTheorem1.6exceptusingTheorem2.6
instead of Theorem 2.4 and is omitted....
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC
VK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC
VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC
VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC
VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA
JH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCC...
Báo cáo khoa học: "A Program for the Machine Translation of Natural Languages" pdf
... information-retaining cells.
The information retained by any particular group of
cells at any one time may be called the state of this
part of the automaton. The state of the entire automa-
ton ...
with a more abstract turn of mind, it is sometimes
called an abstract automaton. Abstract automata, at
least the kind we are interested in, can be thought of
as a...
Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt
... application for the
formalism presented here lies in the domain of
machine translation. The transfer model of
MT may be thought of as involving three dis-
tinct mappings; from the source language ... its interpretation, outline two
alternative rule application regimes, and illus-
trate the use of the formalism in the areas of
machine translation and reduct...
Từ khóa: