Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

báo cáo hóa học:" Oscillation criteria for second-order nonlinear neutral difference equations of mixed type docx

báo cáo hóa học:" Oscillation criteria for second-order nonlinear neutral difference equations of mixed type docx

... Thandapani ∗1 , Nagabhushanam Kavitha 1 and Sandra Pinelas 2 1 Ramanujan Institute for Advanced Study in Mathematics, University of Madras, Chennai 600 005, India 2 Departamento de Matem´atica, Universidade ... neutral difference equations of mixed type Advances in Difference Equations 2012, 2012:4 doi:10.1186/1687-1847-2012-4 Ethiraju Thandapani (ethandapani@yahoo.co.in) Nagabhus...

Ngày tải lên: 21/06/2014, 17:20

21 211 0
Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx

Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx

... negatively dependent random variable, Ph.D. thesis, 2000. 6 V. Fakoor and H. A. Azarnoosh, “Probability inequalities for sums of negatively dependent random variables,” Pakistan Journal of Statistics, ... Journal of Inequalities and Applications work was supported by the National Natural Science Foundation of China 11061012,the Support Program of the New Century Guangxi China T...

Ngày tải lên: 21/06/2014, 07:20

8 326 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... TCGTATTCATACACCGTAC PEx1F CCAATTGCGCTACGCTCCT DNA-shift assay P SEx1 PEx1R CCATGTAGGCGGTGACGA simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift ... TAGAATTCATCGCCACGACCATG DNA-shift assay P R1 SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCG...

Ngày tải lên: 21/06/2014, 17:20

12 455 0
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf

... node is stateless, whereas the collector nodes keep a data track table to maintain the data transfer information. The advantage of the runtime update of near likely node is that the data is stored ... 0.2) (Past, future) study time ( ×100%) KL divergence Trace-based, small dataset 300 Trace-based, large dataset 300 Point-based, small dataset 300 Point-based, large dataset 300 (a) Trans...

Ngày tải lên: 21/06/2014, 18:20

17 362 0
báo cáo hóa học:" Research Article A New Multithreaded Architecture Supporting Direct Execution of Esterel" docx

báo cáo hóa học:" Research Article A New Multithreaded Architecture Supporting Direct Execution of Esterel" docx

... Systems Reset a0 0 a1 1 a0 1 a1 0 a1 2 a2 3 a3 4 a4 3 a4 2 a3 2 a3 1 a2 1 a2 0 a3 0 a4 1 a4 0 a2 2 a3 3 a4 4 A0 A1 A2 A3 A4 (a) State Description: A0 : Abort empty (no ABORT loaded) A1 : Abort Level 1 (AASR1 and AAAR1 loaded with 1st ABORT) A2 : Abort Level 2 (AASR2 and ... AAAR2 loaded with 2nd ABORT) A3 : Abort Level 3 (AASR3 and AAAR3 loaded with 3rd ABORT)...

Ngày tải lên: 21/06/2014, 20:20

19 343 0
Báo cáo hóa học: " Research Article A Hybrid Projection Algorithm for Finding Solutions of Mixed Equilibrium Problem and Variational Inequality Problem" pptx

Báo cáo hóa học: " Research Article A Hybrid Projection Algorithm for Finding Solutions of Mixed Equilibrium Problem and Variational Inequality Problem" pptx

... nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol. 20, pp. 197–228, 1967. 3 F. E. Browder, “Nonexpansive nonlinear operators in a Banach space,” Proceedings ... Theory and Applications 19 14 V. Colao, G. Marino, and H K. Xu, “An iterative method for finding common solutions of equilibrium and fixed point problems,” Journal of Mathematical A...

Ngày tải lên: 21/06/2014, 20:20

19 451 0
Báo cáo hóa học: " Research Article A New System of Generalized Nonlinear Mixed Variational Inclusions in Banach Spaces" pot

Báo cáo hóa học: " Research Article A New System of Generalized Nonlinear Mixed Variational Inclusions in Banach Spaces" pot

... theorems of solutions for the system of nonlinear variational inequalities. As generalizations of system of variational inequalities, Agarwal et al. 18 introduced a system of generalized nonlinear ... new system of generalized nonlinear mixed quasivariational inclusions which contains some classes of system of variational inclusions and systems of variational i...

Ngày tải lên: 21/06/2014, 20:20

15 232 0
Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

... above rate is obtained as a special case of parity- forwarding method in which each relay selects the message of the previous relay, and it is stated that (38) is the capacity of degraded chain ... the Capacity of Some Classes of Multilevel Relay Network Leila Ghabeli and Mohammad Reza Aref Information Systems and Security Lab, Department of Electrical Engineering, Sharif Univer...

Ngày tải lên: 21/06/2014, 22:20

10 318 0
Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

... Silverman and R. Linsker, A measure of DNA periodic- ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300, 1986. [23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and ... parameter available for real-time control, so that a biologist viewing a periodicity characterization of a sequence might subjectively assign a relative weight to each of the...

Ngày tải lên: 22/06/2014, 00:20

8 382 0
Báo cáo hóa học: " Research Article A Nonlinear Decision-Based Algorithm for Removal of Strip Lines, Drop Lines, Blotches, Band Missing and Impulses in Images and Videos" docx

Báo cáo hóa học: " Research Article A Nonlinear Decision-Based Algorithm for Removal of Strip Lines, Drop Lines, Blotches, Band Missing and Impulses in Images and Videos" docx

... with constant intensity having irregular shapes. Kokaram [5]has given a method for removal of scratches and restoration of missing data in the image sequences based on temporal S. Manikandan and D. ... see a dark spot. Line scratches are narrow vertical, or almost vertical, bright/dark lines that a ect a column or a set of columns of the frame. They are also impulsive type ar...

Ngày tải lên: 22/06/2014, 00:20

10 288 0
w