... transmigration of monocytes and macrophages across the BBB to the sites of axonal injury in the brain [33,37]. Both in vitro and in vivo findings suggest that hypoxia/ischemia-induced infiltra- tion of monocytes ... HIF-1-binding sites in the pro- moter regions of MCP-1 and MCP-5 genes. Hypoxia and CoCl 2 up-regulate the expression of both HIF-1α and...
Ngày tải lên: 19/06/2014, 22:20
... Toxicology Open Access Research Airborne particulate matter PM 2.5 from Mexico City affects the generation of reactive oxygen species by blood neutrophils from asthmatics: an in vitro approach Martha ... and soot aggregates of the fine fraction indicates a combination of natural and anthropogenic sources influenced by smelter and incineration...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" ppt
... assigned. Correlation between maternal and infant p24 antigen levels and maternal viral load with maternal and infant p24 antigen Using Spearman's correlation, we examined the associa- tion between maternal ... viral loadHIV enhancement Abstract Background: We examined the association and interaction between maternal viral load and antibodies in verti...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Reverse shoulder arthroplasty leads to significant biomechanical changes in the remaining rotator cuff" doc
... al.: Reverse shoulder arthroplasty leads to significant biomechanical changes in the remaining rotator cuff. Journal of Orthopaedic Surgery and Research 2011 6:42. Submit your next manuscript to ... between muscle insertion sites of the rema ining rotator cuff after RSA. During glenohumeral abduction, significant changes were seen in both, the teres minor...
Ngày tải lên: 20/06/2014, 07:20
báo cáo hóa học:" How do existing HIV-specific instruments measure up? Evaluating the ability of instruments to describe disability experienced by adults living with HIV" pot
... Disability Framework (contextual factors and triggers of disability) . However, these instruments may possess content that relates to the dimensions of disability experienced by adults living with HIV. We only ... over the course of living with HIV. In this paper, we describe the extent to which existing HIV-specific health-status instruments captu...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " An international evaluation of ultrasound vs. computed tomography in the diagnosis of appendicitis" doc
... States standpoint, participated in the design of the study, performed the statistical analysis, and participated in the drafting of the manuscript. All authors read and approved the final manuscript. Competing ... as the first-line test in the case of suspected appendicitis, and its use is increasing [15,16,20]. In this international study, we compared the pe...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
... Lactobacillus reuteri Hema Vaidyanathan 1 , Vijayalakshmi Kandasamy 1 , Gopi Gopal Ramakrishnan 1 , KB Ramachandran 2 , Guhan Jayaraman 2 and Subramanian Ramalingam 1* Abstract In this work, Lactobacillus reuteri has ... doi:10.1007/s00253-010-2678-0. doi:10.1186/2191-0855-1-37 Cite this article as: Vaidyanathan et al.: Glycerol conversion to 1, 3- Propanediol is enhanced b...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " Some new nonlinear integral inequalities and their applications in the qualitative analysis of differential equations" potx
... article as: Zheng and Feng: Some new nonlinear integral inequalities and their applications in the qualitative analysis of differential equations. Journal of Inequalities and Applications 2011 ... doi:10.1016/j.amc.2006.05.013 Zheng and Feng Journal of Inequalities and Applications 2011, 2011:20 http://www.journalofinequalitiesandapplications.co...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific ... Open Access A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA Wang Yu-Hong 1† , Chen Rui 2† and...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf
... = 76.7(%) of total logic elements. Note that with the limitation of EP2C35F672C6, we cannot evaluate 64-sample case or larger. In this paper, towards the realization of RRO-NRDPWT- based ECG data compression ... this paper, a modified run-length coding (MRLC) algorithm i s proposed towards the realization of a RRO-NRDPWT-based ECG data compression...
Ngày tải lên: 21/06/2014, 05:20
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3, in the generalized reaction-diffusion theory 4, in the turbulent flow of a gas in porous medium and in the ... 498–505, 1996. 13 A. V. Lair and A. W. Shaker, “Classical and weak solutions of a singular semilinear elliptic problem, ” Journal of Mathematical A...
Ngày tải lên: 21/06/2014, 20:20
báo cáo hóa học:" Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema" doc
... Processing Volume 2009, Article ID 203790, 13 pages doi:10.1155/2009/203790 Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema Constantine ... 0.40.45 0.5 P FA Withoutrejectoption With reject option Figure 6: Zoom in the experimental ROC curves of the linear classifier applied t...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx
... Nazarpour, S. Sanei, and J. A. Chambers, A novel semi- blind signal extraction approach incorporating PARAFAC for the removal of the removal of eye-blink artifact from EEGs,” in Proceedings of ... measure of performance for the proposed artifact removal method, the CC values of the extracted eye-blink artifact source and the original and...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot
... R −1 η − R −1 η S (P−1) (S H (P −1) R −1 η S (P−1) ) −1 S H (P −1) R −1 η at the beginning of each step, that is, at the beginning of the line search for a de- lay parameter. Without taking into consideration the block diagonal form of R η , as well as the order ... which naturally exploits multipath channel parame- ters. 5. CONCLUSIONS In this paper, a new method...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: "Nitrogen washout/washin, helium dilution and computed tomography in the assessment of end expiratory lung volume" docx
... dividing the difference in peak inspiratory airway pressure and the plateau inspiratory pressure, measured dur- ing an end inspiratory pause, by the inspiratory flow preceding the occlusion. The ... of end expiratory lung volume (EELV) measured by the helium dilution technique and the computed tomography (CT) scanComparison of end expiratory lung...
Ngày tải lên: 13/08/2014, 11:23