Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

... Alvarez 1 Abstract Background: Angiotensin and serotonin have been identified as inducers of cardiac hypertrophy. DNA polymorphisms at the genes encoding components of the angiotensin and serotonin systems have been ... et al., Functional polymorphisms in genes of the Angiotensin and Serotonin systems and risk of hypertrophic cardiomyopath...

Ngày tải lên: 18/06/2014, 16:20

... purposes) Health and Quality of Life Outcomes Open Access Research Development and preliminary evaluation of a quality of life measure targeted at dementia caregivers Barbara G Vickrey* 1 , Ron D Hays 2 , ... item-scale correlations, reliability, and associations of scales with patient and caregiver demographic and caregiving characteristics were esti...

Ngày tải lên: 18/06/2014, 18:20

... citation purposes) Health and Quality of Life Outcomes Open Access Research Validity and internal consistency of a Hausa version of the Ibadan knee/hip osteoarthritis outcome measure Adesola ... different parts (parts 1 and 2; parts 1 and 3; parts 2 and 3; parts 1 & 2 together and part 3) on the Hausa version of IKHOAM indicate that the H...

Ngày tải lên: 18/06/2014, 19:20

... questionnaire assessing the acceptance of influenza vaccination: the Vaccinees' Perception of Injection (VAPI © ) questionnaire Catherine Chevat 1 , Muriel Viala-Danten* 2 , Carla Dias-Barbosa 2 and ... vaccinated again (3 items). The questionnaire was self- administered and was as well adapted to adults as to the elderly. Finalisation and psychomet...

Ngày tải lên: 18/06/2014, 19:20

... The kinematics of, and the dynamic actions on, the CM of the modelled portion of the body involved in the movement are needed as model inputs. The outputs of the TIPs are the kinematic and kinetic ... values, showing a high level of repeatability of the timing of the performance of the task. Conclusions: The distinctive patterns of the sit -to-...

Ngày tải lên: 19/06/2014, 10:20

... article Experimental and analytical validation of a modular acetabular prosthesis in total hip arthroplasty Francisco Romero 1 , Farid Amirouche 1,2 , Luke Aram 1 and Mark H Gonzalez* 1,2 Address: ... interface and polishing of the metallic shell are new advances to limit fractional wear. The loading of the hip joint is cyclical and occurs during gait. Im...

Ngày tải lên: 20/06/2014, 00:20

... complete CCHF virus genome sequence of a virus (strain Kosova Hoti) isolated from a hemorrhagic fever case in the Balkans. This virus strain was isolated from a fatal CCHF case, and passaged only ... supervised the study and revised the final draft. All authors read and approved the final manuscript. The protein analysis of the complete genom...

Ngày tải lên: 20/06/2014, 01:20

... TGAACCGCCAGTTATAACTCAACACAATTATAATAATATTACTTTAAATACTTGTGTTGATTATAATATATATGGCAGAACTGGCCAAGGTTTTATTACTAATGTAACCGACTCAGCTGT H120 1239 M41 1321 G Egypt/F/03 1359 TAGTTATAATTATCTAGCAGACGCAGGTTTGGCTATTTTAGATACATCTGGTTCCATAGACATCTTTGTTGTACAAGGTGAATATGGTCTTAATTATTATAAGGTTAATCCTTGCGAAGA H120 ... ATGTTGGTAACACCTCTTTTACTAGTGACTCTTTTGTG H120 1 M41 1 ACGCCAGTTGTTAATTTGAAAACTGAACAAAAGACAGACTTAGTCTTTAATT...

Ngày tải lên: 20/06/2014, 01:20

... xfyang@theochem.kth.se 1 Jiangsu Laboratory of Advanced Functional materials and College of Physics and Engineering, Changshu Institute of Technology, Changshu 215500, China Full list of author information is available ... al. Nanoscale Research Letters 2011, 6:618 http://www.nanoscalereslett.com/content/6/1/618 Page 9 of 10 NANO IDEA Open Access Fano-Rashba effect in thermoe...

Ngày tải lên: 20/06/2014, 23:20

... Inverse Problems, vol. 24, no. 1, Article ID 015015, 8 pages, 2008. 6 F. Cianciaruso, G. Marino, L. Muglia, and Y. Yao, “On a two-step algorithm for hierarchical fixed point problems and variational ... Fix  T  , 1.7 a variational inequality studied by Yamada and Ogura 10. Example 1.3. Let A be a maximal monotone operator. Taking T  J A λ :I  A −1...

Ngày tải lên: 21/06/2014, 07:20

... Method for In nite Family of Generalized Equilibrium and Fixed-Point Problems of Nonexpansive Mappings in Hilbert Spaces Shenghua Wang 1, 2 and Baohua Guo 1, 2 1 National Engineering Laboratory for ... H. Wang, G. Marino, and F. H. Wang, Strong convergence theorems for a generalized equilibrium problem with a relaxed monotone mapping and a...

Ngày tải lên: 21/06/2014, 11:20

... EURASIP Journal on Image and Video Processing 3 (a) A in camera 1 (b) A in camera 2 (c) B in camera 2 Figure 1: An example of false appearance similarity information. Two subjects ( A and “B”) ... nodes in 6 cameras 15 nodes in 5 cameras 7 nodes in 6 cameras 10 nodes in 2 cameras 25 nodes in 9 cameras and 13 links Performance evaluation NO YES YES YES YES Input...

Ngày tải lên: 21/06/2014, 20:20

... interest in under- standing interacting 1D systems, intertube interactions are of substantial technological importance because SWNTs naturally form bundles in typical syntheses [24] and bun- dling ... interactions). This coupling quenches the radiative recombination opening nonradiative relaxation paths by transferring the energy to the lattice via phonons emission. In addition to monit...

Ngày tải lên: 22/06/2014, 01:20

... method for the variational inequality problem over the intersection of fixed point sets of nonexpansive mappings,” in Inherently Parallel Algorithms in Feasibility and Optimization and Their Applications ... the fixed-point sets of a family of nonexpansive mappings is a task that occurs frequently in various areas of mathematical sciences and engineering. For example, th...

Ngày tải lên: 22/06/2014, 03:20

... Gomathy and S. Shanmugavel Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols C. Go mathy Telematics Lab, Department of Electronics and ... sessions with randomly selected sources and destinations were simulated. Each source transmits data packets at a minimum rate of 4 packets/s and a max...

Ngày tải lên: 23/06/2014, 00:20