Báo cáo hóa học: " Pb(core)/ZnO(shell) nanowires obtained by microwave-assisted method" docx

... gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta ... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcct...

Ngày tải lên: 18/06/2014, 16:20

... purposes) Health and Quality of Life Outcomes Open Access Research Use of medications by people with chronic fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia Roumiana ... and health literacy may have affected the accuracy of these data. Our study was cross-sectional in nature and does not allow fo...

Ngày tải lên: 18/06/2014, 19:20

... of Neuroinflammation Open Access Research Anti-inflammatory therapy by ibudilast, a phosphodiesterase inhibitor, in demyelination of twitcher, a genetic demyelination model Kuriko Kagitani-Shimono 1,2,3 , ... 5'- TTTCTCCTGGTATGAGATAGC-3', TNFR1 forward primer: 5'-CTAAACAGCAGAACCGAGTGT-3', TNFR1 reverse primer: 5'-AGATACGTAGAGTGTCCTTGG-3&...

Ngày tải lên: 19/06/2014, 22:20

... activation and pro- liferation of osteoblast-like cells with enhanced expres- sion of messenger ribonucleic acid and proteins of c-fos and c-jun. Clinical feature of thoracic ossification of ligamentum ... and 2003, 23 of which (16 male and 7 female) were caused by fluorosis. The 23 patients ranged in age from 42 to 72 years (mean 54.8 years). 6 cases had acute onset...

Ngày tải lên: 20/06/2014, 00:20

Ngày tải lên: 20/06/2014, 00:20

... Access Short report Cellular < /b> apoptosis < /b> induced < /b> by < /b> replication < /b> of < /b> hepatitis < /b> B virus: possible link between viral genotype and clinical outcome Yi Wei Lu, Tuan Lin Tan, Jianhua Zhang and Wei Ning Chen* Address: ... were observed under phase contrast microscope, stained by < /b> apoptosis < /b> marker and analyzed by < /b...

Ngày tải lên: 20/06/2014, 01:20

... 9:20 http://www.translational-medicine.com/content/9/1/20 Page 5 of 9 RESEARCH Open Access Optical Nerve Detection by Diffuse Reflectance Spectroscopy for Feedback Controlled Oral and Maxillofacial Laser Surgery Florian Stelzle 1* , Azhar Zam 4 , ... investigate diffuse reflectance spectroscopy for tissue differentiation as the base of a feedback control...

Ngày tải lên: 20/06/2014, 03:20

... rapid diagnostic method of Koi Herpesvirus (KHV) infection by loop-mediated isothermal amplification Hatem Soliman and Mansour El-Matbouli* Address: Institute of Zoology, Fish Biology and Fish ... author Abstract Background: Koi Herpesvirus (KHV) affects both juvenile and adult common carp and koi, and is especially lethal to fry. The high mortali...

Ngày tải lên: 20/06/2014, 04:20

... Young et al.: Differential hRad17 expression by histologic subtype of ovarian cancer. Journal of Ovarian Research 2011 4:6. Young et al. Journal of Ovarian Research 2011, 4:6 http://www.ovarianresearch.com/content/4/1/6 Page ... fold. hRad17 RNA expression differed by subtype. Conclusions: hRad17 is over-expressed in ovarian cancer. This over -expression v...

Ngày tải lên: 20/06/2014, 07:20

... fatigue syndrome and healthy persons: a population-based study of fatiguing illness in Georgia Roumiana S Boneva*, Jin-Mann S Lin, Elizabeth M Maloney, James F Jones and William C Reeves Address: ... with a standardized list of reasons to choose from, and health literacy may have affected the accuracy of these data. Our study was cross-sectional in nat...

Ngày tải lên: 20/06/2014, 16:20

... NANO EXPRESS Open Access Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics Androula Galiouna Nassiopoulou * , Violetta ... Violetta Gianneta and Charalambos Katsogridakis Abstract In this paper, we investigate the formation kinetics of Si nanowires [SiNWs] on lithographically defin...

Ngày tải lên: 20/06/2014, 22:20

... light-emitting material in organic light-emitting field-effect transistors (OLEFETs) [21]. A remaining challenge, however, is the integration of such organic nanofibers into the necessary surrounding circuitry ... 8 NANO EXPRESS Open Access Organic nanofibers integrated by transfer technique in field-effect transistor devices Luciana Tavares * , Jakob Kjelstrup-Han...

Ngày tải lên: 21/06/2014, 04:20

... ocessing Volume 2011, Article ID 290950, 8 pages doi:10.1155/2011/290950 Research Ar ticle Process Neural Network Method: Case Study I: Discrimination of Sweet Red Peppers Prepared by Different Methods Sevcan ... the neural network. These results are encouraging and su ggest that neural ne tworks are potentially useful for discriminating sweet red p...

Ngày tải lên: 21/06/2014, 05:20

... of the SiC nanowires 154 Nanoscale Res Lett (2009) 4:153–156 123 NANO EXPRESS SiC Nanowires Synthesized by Rapidly Heating a Mixture of SiO and Arc-Discharge Plasma Pretreated Carbon Black Feng-Lei ... high-temperature Fig. 1 Schematic diagram of the apparatus for synthesis of SiC nanowires Fig. 2 SEM image and EDX pattern of carbon black afte...

Ngày tải lên: 22/06/2014, 01:20