... 10:691-701. doi:10.1186/1742-2094-8-127 Cite this article as: Weinstock-Guttman et al.: Serum lipid profiles are associated with disability and MRI outcomes in multip le sclerosis. Journal of Neuroinflammation 2011 8:127. Submit ... progres- sion. Increased total cholesterol w as associated with increases in the number of contrast-enhancing lesions on brain MRI...
Ngày tải lên: 19/06/2014, 22:20
... CATGATCAACTGCTCTGATTAC 1741(+) GGGCTTCCCGTACTTTGTG 2321(+) TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nM Ty 2339- AACATTCAGGGAGCTAAATCCAG ... (A) in the multiple cloning site of the vector pGreen. (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI Sac...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Mild hypoglycemia is strongly associated with increased intensive care unit length of stay" pdf
... those without hypoglycemia for the entire cohort of 6,240 patients. Patients with hypoglycemia were older, 1 Mild hypoglycemia is strongly associated with increased intensive care unit length ... (HTML) versions will be made available soon. Mild hypoglycemia is strongly associated with increased intensive care unit length of stay Anna...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học:" Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema" doc
... Processing Volume 2009, Article ID 203790, 13 pages doi:10.1155/2009/203790 Research Article Linear Classifier with Reject Option for the Detection of Vocal Fold Paralysis and Vocal Fold Edema Constantine ... 0.40.45 0.5 P FA Withoutrejectoption With reject option Figure 6: Zoom in the experimental ROC curves of the linear classifier applied t...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article Computational Issues Associated with Automatic Calculation of Acute Myocardial Infarction Scores" doc
... Signal Processing Volume 2008, Article ID 670529, 10 pages doi:10.1155/2008/670529 Research Article Computational Issues Associated with Automatic Calculation of Acute Myocardial Infarc tion Scores J. ... during acute myocardial infarction, ” The Ameri- can Journal of Cardiology, vol. 54, no. 3, pp. 249–255, 1984. [8] P. Schweitzer, “The electrocardiographic dia...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " Research Article Functional Inequalities Associated with Jordan-von Neumann-Type Additive Functional " potx
... Corporation Journal of Inequalities and Applications Volume 2007, Article ID 41820, 13 pages doi:10.1155/2007/41820 Research Article Functional Inequalities Associated with Jordan-von Neumann-Type Additive Functional ... functional inequality associated w ith a 3-variable Cauchy additive functional equation We prove the generalized Hyers-Ulam stability of a fu...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo khoa hoc:" Sporadic ALS is not associated with VAPB gene mutations in Southern Italy" ppt
... number not for citation purposes) Journal of Negative Results in BioMedicine Open Access Brief report Sporadic ALS is not associated with VAPB gene mutations in Southern Italy Francesca Luisa ... Alsin gene located at 2q33 [4]. To date over 100 different missense mutations in the Sod1 gene [5] and up to eight described mutations in the Alsin gene have...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: " Predisposing factors for delirium in the surgical intensive care unit" pps
... deterioration in the homeostasis and physical status of the patient. The objective of our study was to investigate the predisposing factors for delirium in a surgical intensive care unit (ICU) setting. Method ... emergency room. Gen Hosp Psychiatry 1995, 17:371-379. 30. Geary SM: Intensive care unit psychosis revisited: Under- standing and managing delirium in...
Ngày tải lên: 12/08/2014, 18:21
Báo cáo khoa học: "Remifentanil for analgesia-based sedation in the intensive care unit" pdf
... to a strict and goal-orientated algorithm for defining, assessing and reassessing analgesia and sedation is more important than finding the magic bullet for a particular substance [7]. However, ... protocols for sedatives and analgesics is effective in terms of improving clinical outcomes, mainly by avoiding unnecessary overdosing, with prolonged mechanical ventilation and stay i...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: ":Clinically important deep vein thrombosis in the intensive care unit: a survey of intensivists" pot
... addition, a definition of clinically important DVT could be used in future clinical research. Therefore, as a first step toward defining a 'clinically important DVT', we surveyed critical care ... the lack of such data, the con- cept of a clinically important DVT in the critically ill is important because such an assessment may be used to determine...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: "Clinical review: Acid–base abnormalities in the intensive care unit" doc
... utility identified in some studies that is conspicuously lacking in others? The answer may be found in the timing. Much like base excess, the value of the SIG may be related to the time of assay. ... for other injuries in isolation or combination. The interpretation of SBE must therefore incorporate the injury complex into decision-making, perhaps limiting its utility. A...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: " A stronger approach to weakness in the intensive care unit" doc
... distally in the Figure 1 A flow chart giving an approach to generalized weakness and/or ventilatory failure in the intensive care unit. CK, creatine kinase; CSF, cerebrospinal fluid; GBS, Guillain–Barré ... and their relative contributions to the weakness may vary considerably when this occurs. Elevated serum creatine kinase may help to identify CIM, but the peak...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo khoa học: "Bench-to-bedside review: Dealing with increased intensive care unit staff turnover: a leadership challenge" pdf
... = intensive care unit. Critical Care October 2005 Vol 9 No 5 Laporta et al. Abstract Critical care leaders frequently must face challenging situations requiring specific leadership and management ... HCS Staffing levels. Intensive Care Society Standards Committee National AHP and HCS Critical Care Advisory Group, Critical Care Pro- gramme Modernisation Agency [http://www.i...
Ngày tải lên: 12/08/2014, 22:21
Báo cáo khoa học: "Elevated troponin and myocardial infarction in the intensive care unit: a prospective study" potx
... classified as having MI or no MI during their ICU stay [2]. Statistical analysis We report continuous data as mean and standard deviation or median and interquartile range (IQR), as appropriate. ... evidence of myocardial ischemia. An elevated troponin alone cannot establish a diagnosis of myocardial infarction (MI), yet the optimal methods for diagnosing MI in the intens...
Ngày tải lên: 12/08/2014, 22:22
Báo cáo khoa học: "Changes in appetite related gut hormones in intensive care unit patients: a pilot cohort study" doc
... purposes) Vol 10 No 1 Research Changes in appetite related gut hormones in intensive care unit patients: a pilot cohort study Mohsen Nematy 1 , Jacqui E O'Flynn 2 , Liesl Wandrag 2 , Audrey E Brynes 3 , ... preparation. All authors read and approved the final manuscript. Acknowledgements We thank ICU staff at both Hammersmith and Charing Cross hospitals (CXH) f...
Ngày tải lên: 12/08/2014, 23:21