Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... were prepared for high performance liquid chromatograp hy (HPLC) analysis of globin chain expression and DNA was isolated for bisulfite sequence analysis. Baboon Treatments Two baboons (...

Ngày tải lên: 18/06/2014, 16:20

... based on online measurement of the participant's performance. Adapting control parameters has the poten- tial advantage that the assistance can be automatically tuned to the participant's ... a deadband that assisted spinal-transected mice to step following a nominal step trajectory with bilateral coordination, and was compared with a fixed training trajectory, and an assi...

Ngày tải lên: 19/06/2014, 08:20

... a patient's daily life activities allows a more reliable assess- ment of a patient's disabilities, and aids in developing rehabilitation treatments and programs, as well as assess- ing a treatment's ... template matched to an array of sensors spanning the joints of interest. In this way, a sensor array can be taken off and put back on an individual for multipl...

Ngày tải lên: 19/06/2014, 10:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads...

Ngày tải lên: 18/02/2014, 14:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ ,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes t...

Ngày tải lên: 19/02/2014, 12:20

... eneral de Asuntos del Personal Acad- emico (DGAPA), UNAM to L.D.P. The authors are grateful to Dr Martin S. Williamson, IACR- Rothamsted, UK, for sharing the para and tipE clone; C. Maertens and ... phaiod- actylus, collected in Baja California, Mexico. We have isolated and chemically and functionally characterized th is peptide. The gene that codes for the toxin and several iso...

Ngày tải lên: 07/03/2014, 16:20

... lipid (CAAX motif) (C standing for cysteine, A for generally aliphatic amino acid, and X for any amino acid). Mammalian Alix and its yeast ortholog, Bro1, are known to associate with charged multivesicular ... has a point mutation at amino acid 408, was c reated by PCR-based site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC AC...

Ngày tải lên: 16/03/2014, 06:20

... Center of basic re- search LC536 and in the National Research Pro- gramme II project 2C06009. 6 A word sketch is a one-page corpus-derived account of a word’s grammatical and collocation behaviour. 7 The ... Automatic Thesaurus Discovery. Kluwer. Jaroslava Hlav a cov a and Pavel Rychl´y. 1999. Dispersion of words in a language corpus. In Proc. TSD (Text Speech Dialogue), pages...

Ngày tải lên: 31/03/2014, 01:20

... superfamily and share structural and functional characteristics. In the mal- arial parasite, Plasmodium falciparum, a functional thio- redoxin and glutathione system have been demonstrated and are ... malaria; Plasmodium falciparum; redox-metabolism; thioredoxin superfamily. The malarial parasite, Plasmodium falciparum is respon- sible for more than 2 million deaths per year and...

Ngày tải lên: 31/03/2014, 07:20

... tremor Tool Parameter analyzed Clinical scales Clinical scores of disability Videos Clinical characterization of tremor Quantification of drawings Evaluation of tremor in 2 dimensions Surface and needle ... within the basal ganglia system, especially the pallidum and the subthalamic nucleus, but are mainly synchronized by cortical activity via the striatal inputs. There is an abnormal cou...

Ngày tải lên: 18/06/2014, 15:20