Báo cáo hóa học: " A stabilized mixed discontinuous Galerkin method for the incompressible miscible displacement problem" pdf
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... performs the casting technique in all the patients. DP participate and analysis the study. HC designed and coordinated and drafted the manuscript. All authors read and approved the final manuscript. Figure ... Department, M.P.Shah Medical College, Guru Govind Singh Hospital, Jamnagar - 361008. Gujarat. India Full list of author information is available at the end of the article...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... performs the casting technique in all the patients. DP participate and analysis the study. HC designed and coordinated and drafted the manuscript. All authors read and approved the final manuscript. Figure ... were performed twice a day till the weight bearing age (when the brace was applied for twenty three hours a day) and five times daily for the next three yea rs (...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 ... tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcgg...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " A virtual reality extended neuropsychological assessment for topographical disorientation: a feasibility study" pot
... 38:820-836. 21. Tirassa M, Carassa A, Geminiani G: A theoretical framework for the study of spatial cognition. In Spatial Cognition Edited by: O'Nuallain S. Amsterdam: Benjamins; 2000:19-31. ... considered the main feature of topographical disorientation disease. The integration of virtual reality with traditional evalua- tion methods may provide an interesting alternative to...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " A biologically inspired neural network controller for ballistic arm movements" ppt
... of the arm. At the end of each task, a standard back-propagation algorithm with momentum is used for the training and thus the variation of the weights. The training of the artificial neural ... to map the working space and reach the desired tar- gets. Even if the learning scheme can be considered as a functionality of the Neural System, a separate paragraph in...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" A comparative study of some methods for color medical images segmentation" doc
... about typical shape and image data characteristics. But, manual segmentation is a very time-consuming process for the already increasing amount of medical images. As a result, reliable automatic methods ... that the values for GCE and LCE are lower in the case of hexagonal segmentation. The error measures, for almost all tested images, have smaller values in the case of t...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" potx
... cited as a reason to reject a manuscript and deserves further study. Additional material Additional file 1: Survey Questionnaire. The data provided represents the survey questionnaire Author details 1 Department ... and CBH designed the questionnaire. CBH analysed the data and wrote the manuscript. All authors contributed to the manuscript. Competing interests The authors de...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" A retrospective study of risk factors for poor outcomes in methicillin-resistant staphylococcus aureus (MRSA) infection in surgical patients" pptx
... collection and analysis, drafted the manuscript and coordinated the study. SM participated in statistical analysis, creation of figures and tables and addressing the corrections. CE participated in ... Johnson AP, Aucken HM, Cavendish S, et al: “Dominance of EMRSA-15 and -16 among MRSA causing nosocomial bacteraemia in the UK: analysis of isolates from the European Antimicrobial Res...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" A survey of orthopaedic journal editors determining the criteria of manuscript selection for publication" pot
... second language or have access to a translator. Non-respon- dents were approached again 2 months later then 6 months later. The editors were informed that the survey was confidential and that their ... cited as a reason to reject a manuscript and deserves further study. Additional material Additional file 1: Survey Questionnaire. The data provided represents the survey questionn...
Ngày tải lên: 20/06/2014, 07:20
Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf
... hörte dass Hans einen Unfall hatte Susi heard that Hans an accident had und dass f Hans f sterben könnte and that Hans die might ‘Susi heard that Hans had an accident and might die’ • Categorial ... Grammar; Steedman (2000) for Combinatory Categorial Grammar; Bateman, Matthiessen & Zeng (1999) for Functional Grammar. Genera- tors that do include an autonomous component for coordinat...
Ngày tải lên: 22/02/2014, 02:20