Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx

... Access Research Retinal pigment epithelial cells secrete neurotrophic factors and synthesize dopamine: possible contribution to therapeutic effects of RPE cell transplantation in Parkinson's ... pro- tein bands. The protein DAT could not be detected in RPE cells. (B) The cDNA of DDC but not DAT was detected by PCR from the total cDNA of...

Ngày tải lên: 18/06/2014, 15:20

... hepatic cancer, colon cancer and lung cancer. Immunostaining of prostate cancer tissue with antibodies against AMACR and PSAFigure 2 Immunostaining of prostate cancer tissue with antibodies against ... mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) . In contrast, t...

Ngày tải lên: 18/06/2014, 15:20

... conception, design, and acquisition of data, analysis and interpretation of data, writing and approval of the manuscript. Competing interests The author declares that they have no competing interests. Received: ... be used instead of VAD. Finally, DAPK methylation and oligoclonal reconstitu- tion as potential adverse and favorable risk factors in mye- loma warrants furth...

Ngày tải lên: 18/06/2014, 16:20

... RESEARCH Open Access Sliding and pressure evaluation on conventional and V-shaped seats of reclining wheelchairs for stroke patients with flaccid hemiplegia: a crossover trial Hsiu-Chen Huang 1,2 , ... reduce the forward sliding and sacral peak pressure of stroke patients with flaccid hemiplegia. The back displacement of able-bodied su...

Ngày tải lên: 19/06/2014, 08:20

... Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S, Yambe T, Nitta S: Evaluation of adaptation to visually induced motion sickness based on the maximum cross-correlation between pulse transmission ... of 9 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Could sound be used as a strategy for reduc...

Ngày tải lên: 19/06/2014, 08:20

... detection of the level of dopaminergic neuronal terminals, and for normalization of the loading protein. The signal was vis- ualized by enhanced chemiluminescence according to the instructions of the ... activation of microglia in the rat 6-hydroxy dopamine-induced PD model [32]. We show for the first time a direct correlation between COX-2 and microglia a...

Ngày tải lên: 19/06/2014, 22:20

... Wang et al.: Aspirin-triggered lipoxin A 4 attenuates LPS-induced pro-inflammatory responses by inhibiting activation of NF- B and MAPKs in BV-2 microglial cells. Journal of Neuroinflammation 2011 ... or by potentiating glutamate release, thereby enhancing excitotoxi city [41]. IL-1b and TNF-a also drive self-propagating cycles of microglial activation...

Ngày tải lên: 19/06/2014, 22:20

... amplifica- tion the left arm (KpnI F: GGTACCAATCTCAACTAGA- GACACTCTTGA) and (ClaI R: ATCGATGCACAAATATTTAATTGCCAG), and the right arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC) and (BamHI R: GGATCCAATGAGTTGATCTCTGTGA- GAACT). ... analysed by electrophoresis on a 2% agarose gel. The primer pairs used were ACMV DNA A F: CTCAACTAGAGACACTCTTGA and R: CACAAATATT- TAATTGCCAG, Tnt-retroposon (GenBa...

Ngày tải lên: 20/06/2014, 04:20

... solution onto a planar silicon surface. The adsorption of nanoparticles onto silicon is described and the surface density obtained is investi gated in function of the usual experimental param eters: ... distribution was obtained and adsorption was irreversible. The density o f a gold nanoparticle assembly was investigated and analyzed in relation to sev- eral parameters suc...

Ngày tải lên: 20/06/2014, 22:20

... NANO REVIEW Open Access Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons Artur Medvid * , Pavels ... Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, ph...

Ngày tải lên: 20/06/2014, 22:20

... Ruiz Zamarreño, Francisco Javier Arregui and Ignacio Raúl Matías Abstract In this work a novel antibacterial surface composed of an organic-inorganic hybrid matrix of tetraorthosilicate and a polyelectrolyte ... NANO EXPRESS Open Access An antibacterial coating based on a polymer/sol- gel hybrid matrix loaded with silver nanoparticles Pedro José Rivero * , Aitor...

Ngày tải lên: 21/06/2014, 04:20

... transistors based on a dielectrophoretically aligned nanowire array WooSeok Choi 1 , Taechang An 1 and Geunbae Lim 1,2* Abstract In this study, we synthesized an organic electrochemical transistor ... a carbon nanotube-Nafion (CNT-Nafion) suspension. Dielectrophoretically aligned nanowires formed a one-dimensional submicron bundle betwe en triangular electrodes. The...

Ngày tải lên: 21/06/2014, 04:20

... 6:148 http://www.nanoscalereslett.com/content/6/1/148 Page 3 of 6 NANO EXPRESS Open Access Properties of silicon dioxide layers with embedded metal nanocrystals produced by oxidation of Si:Me mixture Andrei Novikau 1* , ... 86:013107. doi:10.1186/1556-276X-6-148 Cite this article as: Novikau et al.: Properties of silicon dioxide layers with embedded...

Ngày tải lên: 21/06/2014, 05:20

... the last one plays a role only in thin layers, and it is responsible for the reduction of the electric conductivity of thin layers [8]. Mathematical formula for the calculation of relaxation times ... nanoparticle decreases [5-7]. Properties of metal layers are affected by electron scattering on phonons, on imperfections, and at layer boundaries. While the first two types of s...

Ngày tải lên: 21/06/2014, 06:20

... REVIEW Properties and applications of quantum dot heterostructures grown by molecular beam epitaxy M. Henini Published online: 26 July 2006 Ó to the authors 2006 Figure 14 shows plots of the ... Schematic diagram of the density of states (DOS) in the conduction band (CB) and valence band (VB) for a (a) double heterostructure, (b) quantum well, (c) quantum wir...

Ngày tải lên: 22/06/2014, 22:20