Báo cáo hóa học: " Strong consistency of estimators in partially linear models for longitudinal data with mixingdependent structure" pdf

Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx

... 8:13 http://www.translational-medicine.com/content/8/1/13 Page 8 of 9 RESEARC H Open Access The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer Qiang Zhou 1,2 , Rui-Qing Peng 1,2 , Xiao-Jun ... M: Evaluation of risk of liver metastasis in colorectal adenocarcinoma based on the combination o...

Ngày tải lên: 18/06/2014, 16:20

9 829 0
báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

... Access Research Enhancing quality of life in older adults: A comparison of muscular strength and power training Jeffrey A Katula* † , W Jack Rejeski and Anthony P Marsh Address: Department of Health & ... types of resistance training and a control on changes in measures of quality of life and self- efficacy in older adults. The data...

Ngày tải lên: 18/06/2014, 19:20

8 550 0
Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc

Báo cáo hóa học: " The role of feed-forward and feedback processes for closed-loop prosthesis control" doc

... 8:60 http://www.jneuroengrehab.com/content/8/1/60 Page 12 of 12 RESEARC H Open Access The role of feed-forward and feedback processes for closed-loop prosthesis control Ian Saunders * and Sethu Vijayakumar Abstract Background: ... the role of feedback under motor uncertainty, such as is more typical in real-world situations. We added random delays to the hand...

Ngày tải lên: 19/06/2014, 08:20

12 504 0
báo cáo hóa học:" The results of arthroscopic versus mini-open repair for rotator cuff tears at mid-term follow-up" pot

báo cáo hóa học:" The results of arthroscopic versus mini-open repair for rotator cuff tears at mid-term follow-up" pot

... closed. The postoperative regimen for the arthroscopic repair was identical to that for the mini-open repair. Analysis of the Data and Statistics Descriptive analysis was performed for patient demo- graphics ... 1 of 8 (page number not for citation purposes) Journal of Orthopaedic Surgery and Research Open Access Research article The results of arthroscop...

Ngày tải lên: 20/06/2014, 01:20

8 467 0
báo cáo hóa học:" The accuracy of MRI in the detection of Lumbar Disc Containment" docx

báo cáo hóa học:" The accuracy of MRI in the detection of Lumbar Disc Containment" docx

... and has a place in the provision of informed consent. That said, studies evaluating the accuracy of MRI in the detection of lumbar disc containment have been insuffi- cient. While MRI has been shown ... depiction of liga- mentous integrity. The sum of these factors (coupled with extrinsic factors including those involved in the actual readings of the...

Ngày tải lên: 20/06/2014, 01:20

6 479 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC- CGGGTTTATTTCCTAAAAT GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG- GAAATGTTGAATACTCA TACTCTTCCTTTTTC-3'. The linear PCR-generated frag- ments were electroporated into YEbac102, ... pCR2 .1 (Invitrogen) using the follow- ing primers: 5'-AGGGCGGGGGCATCGGGCACCGGGAT- GGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC- GACAGCAAGCGAACCGGAAT-3...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx

Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx

... illustration of attachment to C. jejuni strain L4 (Fig. 2a, b). Bacteriophage PV22 interacted with C. jejuni by attachment followed by translocation of the phage to the polar region of the bacterium up to ... jejuni (Fig. 2c). Interestingly, PV22 did not appear to inject its DNA into C. jejuni. The constant of velocity of PV22 adsorption on cells was...

Ngày tải lên: 20/06/2014, 01:20

5 261 0
báo cáo hóa học:" Elevated expression of CDK4 in lung cancer" ppt

báo cáo hóa học:" Elevated expression of CDK4 in lung cancer" ppt

... phosphorylating the retinoblastoma protein. Over- expression of CDK4 has been described in many tumors, including lung cancer. In this investigation, we analyzed the e xpression of CDK4 protein in lung ... Strong expression of CDK4 in lung cancer samples; C and D: Weak expression of CDK4 in lung cancer sample; E:Weak expression of CDK4 in normal...

Ngày tải lên: 20/06/2014, 03:20

9 380 0
báo cáo hóa học:" The value of SPECT in the detection of stress injury to the pars interarticularis in patients with low back pain" doc

báo cáo hóa học:" The value of SPECT in the detection of stress injury to the pars interarticularis in patients with low back pain" doc

... reviewed findings on planar and SPECT bone scintigraphy in 162 patients aged 6-32 years with symptoms of low back pain potentially related to stress injury of the pars interarticularis. SPECT showed ... this article as: Zukotynski et al.: The value of SPECT in the detection of stress injury to the pars interarticularis in patients...

Ngày tải lên: 20/06/2014, 04:20

6 448 0
báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot

báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot

... 74:4 9-6 0. doi:10.1186/174 9-7 99X- 5-8 0 Cite this article as: Modi et al.: Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature ... Access Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column pl...

Ngày tải lên: 20/06/2014, 04:20

8 381 0
báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf

báo cáo hóa học:" Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian cancer" pdf

... Central Page 1 of 9 (page number not for citation purposes) Journal of Ovarian Research Open Access Review Emerging role of microRNAs in diagnosis and treatment of various diseases including ovarian ... Detailed understanding of the characteristic miRNA abnormalities could contribute to novel approaches in early diagnosis and treatment of different...

Ngày tải lên: 20/06/2014, 07:20

9 441 0
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx

báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx

... con- servative approach to informing and obtaining assent from children who participated in the operational research, which was approved by all affiliated institu- tional review boards. We obtained ... included as a part of the assent process prior to research participation, a component of research participation, or not incorporated in any aspect of the child's...

Ngày tải lên: 20/06/2014, 08:20

10 373 0
Báo cáo hóa học: " Strong consistency of estimators in partially linear models for longitudinal data with mixingdependent structure" pdf

Báo cáo hóa học: " Strong consistency of estimators in partially linear models for longitudinal data with mixingdependent structure" pdf

... 2011:112 http://www.journalofinequalitiesandapplications.com/content/2011/1/112 Page 10 of 18 RESEARCH Open Access Strong consistency of estimators in partially linear models for longitudinal data with mixing- dependent ... case of (x T i j , t ij ) being random. The interested readers can consider the work. In addition, we consider partially linear models...

Ngày tải lên: 20/06/2014, 22:20

18 405 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

... 2011:53 http://www.fixedpointtheoryandapplications.com/content/2011/1/53 Page 5 of 10 RESEARC H Open Access Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems Yonghong ... Cambridge (1990) doi:10.1186/1687-1812-2011-53 Cite this article as: Yao et al.: Strong convergence of a hybrid method for monoton...

Ngày tải lên: 20/06/2014, 22:20

10 425 0
w