Báo cáo toán học: " Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports" ppt

... population genetics, see Fleming [1]. That an allele A 1 holds an advantage over a rival allele A 2 at some points and holds an disadvantage over A 2 at some other points can be presented by changing ... Fundamental Research Funds of the Gansu Universities. Authors’ contributions The authors declare that the study was realized in collaboration with the same responsibility. All autho...

Ngày tải lên: 20/06/2014, 20:20

... is an elementary matter to check that T is a completely continuous opera- tor from C(I) into itself (one has to take Remark 1 into account). Therefore, Schauder’s Theorem ensures that T has a ... Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Minimal and maximal solutions to...

Ngày tải lên: 20/06/2014, 20:20

... organs were too low at this time point to be of any statistical value. Figure 3 HPLC chromatograms of serum incubations of cetuximab-IRDye800CW. HPLC chromatograms at 280 nm (black line, A) andat 780 ... facil itate analy- tical procedures to study, analyze, and quantify the inertness of dye coupling to mAbs. At a later s tage, such conjugates might be applied in a multimod...

Ngày tải lên: 20/06/2014, 21:20

... form of GluV8 (Met1-Ala336) was amplified with a pair of primers (5¢- ATGGGATCCAAAGGTAAATTTTTAAAAGTTAGTT CT-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAGG TATATTG-3¢) and then processed as described above. T. ... (Met1-Gln282) was amplified with a pair of prim- ers: 5¢-TATGGATCCAAAAAGAGATTTTTATCTATATG TAC-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAG GTATATTG-3¢. BamHI sites introduced in the primers a...

Ngày tải lên: 16/03/2014, 06:20

... this article as: Kreienbuehl et al.: Community-acquired necrotizing pneumonia due to methicillin-sensitive Staphylococcus aureus secreting Panton-Valentine leukocidin: a review of case reports. Annals ... Luna VA, Sanderson R: Fatal necrotizing pneumonia due to a Panton-Valentine leukocidin positive community- associated methicillin-sensitive Staph...

Ngày tải lên: 20/06/2014, 21:20

... Luna VA, Sanderson R: Fatal necrotizing pneumonia due to a Panton-Valentine leukocidin positive community-associated methicillin- sensitive Staphylococcus aureus and Influenza co-infection: a case ... Kobayashi SD, Ayeras AA, Ashraf M, Graves SF, Ragasa W, Humbird T, Greaver JL, Cantu C, Swain JL, Jenkins L, Blasdel T, Cagle PT, Gardner DJ, DeLeo FR, Musser JM: Lack of...

Ngày tải lên: 18/06/2014, 18:20

... neutral acceptor-bound excitons (labeled as L1) were systematically investigated as a function of temperature and of alloy composition. The parameters that describe the temperature variation of ... magneto-optical switches, and solar cells [3]. Recently, CMT has attracted much interest as a potential material for applications in the gamma-ray detectors because of a wide band...

Ngày tải lên: 20/06/2014, 20:20

... Miyayama M: Large remanent of polarization of vanadium- doped Bi 4 Ti 3 O 12 . Appl Phys Lett 2001, 78:1903-1905. 7. Kojima T, Sakai T, Watanabe T, Funakubo H, Saito K, Osada M, Large remanent ... increased the remanent polarization of over 10 µC/cm 2 , and this value was shown to be much larger than that of the BLT ceramic, due to a reduction of domain pinning oxygen vac...

Ngày tải lên: 20/06/2014, 20:20