Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
... appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. A novel method for crystalline silicon solar cells with low contact resistance and antireflection ... in any medium, provided the original work is properly cited. A novel method for crystalline silicon solar cells with low contact resist...
Ngày tải lên: 20/06/2014, 21:20
... varia- bles were therefore analysed with repeated measure MANOVA, which revealed a significant change (p = 0,045). Since the MANOVA was significant, the depend- ent variables were analysed with ... authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical wor...
Ngày tải lên: 19/06/2014, 08:20
... reduce ion channeling [7]. The implanted NWs were subsequently annealed by rapid thermal annealing (RTA) at 850°C for 30 s in Ar atmosphere. Afterward, the SOG was removed using an HF-dip resulting ... heavy mass compared to phosphorus, the Au caps on top of the NWs were removed (Fig. 1c) by an aqueous solution of KI and I 2 , a standard Au etchant. This resulted in the reductio...
Ngày tải lên: 22/06/2014, 00:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... supplied with the enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, a...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... measures such as c-values (Frantzi, Anadiou & Mima 2000, Maynard & Anadiou 2000) and standard statistical significance tests such as the t-test, the chi-squared test, and log- likelihood ... word forms were excluded from the analysis so as not to bias the results against them. Separate lists of bigrams and trigrams were extracted and ranked according to several standard...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... fibroblasts, melanocytes and melanoma cells were carried out according to s tandard protocols described previously [12,22,23]. Normal human epidermal k eratino- cytes and melanocytes, and dermal ... in Genomics and Bioinformatics (to A. S.), UTHSC, and NIH grants 1R01-AR047079-0 1A2 (to A. S.) and RR017854. W e thank Professor Cedric Shackelton, Children’s Hospital Oakland Rese...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... of ACL 94. Ido Dagan, Shaul Marcus, and Shaul Markovitch. 1995. Contextual word similarity and estimation from sparse data. Computer, Speech and Language, 9:123–152. Ido Dagan, Lillian Lee, and ... smoothing, regularization, margin maximization and so on (Chen and Goodman, 1998; Chen and Rosenfeld, 2000; Cortes and Vap- nik, 1995). Recently, the Bayesian approach has emerged...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... Press, Cam- bridge, England, 1985. [8] Perelra, F. C. N. and D. H. D. Warren. Definite clause grammars for language analysis - a survey of the formal- ism and a comparison with augmented transition ... language processing systems requiring large grammatical descriptions that contain disjunctive information, and refined as necessary and appropriate for specific applicat...
Ngày tải lên: 31/03/2014, 17:20
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
... to the 3'-UTR (lanes 3 and 4 versus 5 and 6, or lanes 7 and 8 versus 9 and 10). For amplicon 2, AMV- RT and M-MLV RT worked equally well (lanes 3 and 4 ver- sus 7 and 8, or lanes 5 and 6 versus ... Leukemia Virus Reverse Transcriptase (M-MLV RT; Promega) and Enhanced Avian Reverse Transcriptase (AMV-RT; Sigma), an enhanced avian myeloblastosis virus reverse tran- sc...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
... effective channels and frequency bands for control. We calculated each Bhattacharyya dis- tance according to (1), where M i and Σ i are the mean vec- tor and covariance matrix of class i ( = ... the potential of naturalistic pacing, it still features somewhat unnatural control methods (hand, foot, and tongue motor imagery), as well as variable accuracy and high computational dema...
Ngày tải lên: 19/06/2014, 08:20