0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Toán học >

Báo cáo toán học: " Pretargeted immuno-PET of CEA-expressing intraperitoneal human colonic tumour xenografts: a new sensitive detection method" doc

Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

Tài liệu Báo cáo khoa học: Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits docx

... oligonucleotides,5¢-GATGAATTCGGAGGTTTAAATTTATGTACCAACCTGTCGCTCTATTTA-3¢ and 5¢-CAATTCAAGCTTAATGATGATGATGATGATGCTCCAGTTCATAACGTAAAGCCTCAGCGG-3¢. The amplified DNA was digestedwith Eco RI and HindIII, and then ... of pJY310 [7] was amplified by PCR using a pair of oligonu-cleotides, 5¢-GAGCTCGAAGGAGATATAAATATGAATAAGATCCTGTTGCAATGC-3¢ and 5¢-AAGCCTGCAGTTTTTGTTCCACCAATATCAAACCC-3¢. The amplifiedDNA was digested ... that encodesLolE with a His-tag at its C-terminus, PCR was performedwith pJY310 as a template and a pair of oligonucleotides,5¢-GATGAATTCGGAGGTTTAAATTTATGGCGATGCCTTTATCGTTATTAA-3¢ and 5¢-CAATTCAAGCTTAATGATGATGATGATGATGCTCCAGCTGGCCGCTAAGGACTCGCGCAG-3¢....
  • 10
  • 530
  • 0
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx

... GCTTTTAAAGTTGACTTCAAAG2 CTTTGAAGTCAACTTTAAAAGC3 CTACCATGGCACCTCCTTCTTCTTTCTCAA4 GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA5 CTACCATGGCCCCCATCTCTTTTAGTCAT6 GCTGTCGACTCAGTTCGGGCATTGCTCACB. Altermark ... and the mean values are drawn.ABFig. 8. Cleavage of plasmid, dsDNA and ssDNA. (A) 14 nM VcEndAincubated at 23 °C for 5 min with plasmid (lane 2), dsDNA (lane 4)and ssDNA (lane 6). Substrate ... that each of the enzymes face in their naturalenvironments. Thermal scans of VcEndA at [NaCl]optimal for VsEndA (425 mm) revealed a higher Tm,and a thermal scan performed on VsEndA at [NaCl]optimal...
  • 12
  • 565
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "The impact of language models and loss functions on repair disfluency detection" pptx

... noisy-channel model. We show that language mod-els trained on large amounts of non-speechdata improve performance more than a lan-guage model trained on a more modest amount of speech data, and ... a similar formula.9 ResultsWe follow Charniak and Johnson (2001) and splitthe corpus into main training data, held-out train-ing data and test data as follows: main training con-sisted of ... automatic disfluency detection. Schuleret al. (2010) propose a Hierarchical Hidden MarkovModel approach; this is a statistical approach whichbuilds up a syntactic analysis of the sentence andmarks...
  • 9
  • 609
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Automatic Evaluation of Machine Translation Quality Using Longest Common Subsequence and Skip-Bigram Statistics" doc

... and human perform-ance and the reference translations are usually the only human translations available. Using this pro-cedure, we are able to estimate average human per-formance by averaging ... NIST. 2002. Automatic Evaluation of Machine Translation Quality using N-gram Co-Occurrence Statistics. AAAAAAAAAAA http://www.nist.gov/speech/tests/mt /doc/ ngram-study.pdf Pantel, P. and Lin, ... large-scale machine translation evalua-tions. Recently, Turian et al. (2003) indicated that standard accuracy measures such as recall, preci-sion, and the F-measure can also be used in evalua-tion...
  • 8
  • 442
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... Katayama Y, Hiraishi A & Kuraishi H (1995) Para-coccus thiocyanatus a new species of thiocyanate utiliz-ing facultative chemolithotroph, and transfer of Thiobacillus versutus to the genus Paracoccus ... diffraction data of the wt and M100K crystalswere collected on an in-house beam using a MAR345Image Plate detector. The crystals were mounted in a capil-lary and datasets at 295 K and were measured ... dehydro-genase electron transfer chain. Adv Inorg Chem 45,351–407.3 Lommen A, Ratsma A, Bijlsma N, Canters GW, VanWielink JE, Frank J & Van Beeumen J (1990) Isola-tion and characterization of...
  • 15
  • 509
  • 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... TGCTTCATCTTGCTGACGTGTACGTGGGACTC27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGCC29 5A AAAATGGCCTACAGTTTAGCTCGGTACCW31 5A CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATATC32 6A GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT234 ... AAATGAGCCCAACAAAGCCGAGAAAAACATTI9 7A- R9 8A AATTTGATGCTCGACAGGCTGCCGCGGAGACATGGW10 1A CAATCCGGGAGACAGCTGGTGATGAAAAF11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTTGCAGCCGCGGCCAAAAATGW16 2A TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A ... TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A AGATGGGTTGGCAACTTTCGCTTCAAAAD17 7A- D17 9A- F18 1A TGAAAACCGCCAGTGCTATTGCTGTGAACAP23 3A- P23 4A CCTGACAGCAACTACGCAGCGTTCTGTTCAGC23 6A AGCAACTATCCACCGTTCGCTTCAGGGACTGE26 4A TGCTTCATCTTGCTGACGTGTACGTGGGACTC271A...
  • 7
  • 404
  • 0
Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

Báo cáo khoa học: Catalytic mechanism of the primary human prostaglandin F2asynthase, aldo-keto reductase 1B1 – prostaglandin D2 synthase activity in the absence of NADP(H) pptx

... (F)(5¢-GACTGCGCCCAGGTGTTCCAGAATGAGAAG-3¢)and (R) (5¢-CTTCTCATTCTGGAACACCTGGGCGCAGTC-3¢); AKR1B3 H110F (F) (5¢-GATCTCTACCTTATTTTCTGGCCAACGGGG-3¢) and (R) (5¢-CCCCGTTGGCCAGAAAATAAGGTAGAGATC-3¢) (the italic codonsindicate ... (5¢-CCTCTACCTTATTTTCTGGCCGACTGGC-3¢) and (R) (5¢-GCCAGTCGGCCAGAAAATAAGGTAGAGG-3¢); AKR1B1 H11 0A (F) (5¢-CCTCTACCTTATTGCCTGGCCGACTGGC-3¢) and (R) (5¢-GCCAGTC-GGCCAGGCAATAAGGTAGAGG-3¢); AKR1B3 Y48 F (F)(5¢-GACTGCGCCCAGGTGTTCCAGAATGAGAAG-3¢)and ... (5¢-CACATGGGCACATTCGATGTGGCGGTACCC-3¢); AKR1B1 Y48F (F)(5¢-CTGTGCCCATGTGTTCCAGAATGAGAATG-3¢)and(R) (5¢-CATTCTCATTCTGGAACACATGGGCACAG-3¢);AKR1B1 K77L (F) (5¢-CTTCATCGTCAGCCTGCTGTGGTGCACG-3¢) and...
  • 11
  • 390
  • 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

... D. melanogaster (AAB60217), A. gamb-iae (EAA06264), A. aegypti (AAK15810), S. invicta(AAP92450) and P. americana (BAC02725), and the verte-brates Anguila japonica (BAB64337), Conger myriaster(BAB64338), ... differentdevelopmental stages using the General Elute MammalianTotalRNA kit (Sigma, Madrid, Spain). A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madi-son, WI, USA) and reverse transcribed ... 10Anopheles gambiae (46%) A A B YWXD B YWXD B A B YWXD BH2NLBD1 EGF LBD2SPEGF O TM CBlattella germanicaCD. melanogaster A. gambiae A. aegyptiS. invictaB. germanicaP. americanaX....
  • 11
  • 414
  • 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx

... Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori KanayaDepartment of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella ... theNdeI–BamHI sites of pET-2 8a. This DNA fragment wasamplified by PCR. The sequences of the PCR primers were5¢-AGAGAGAATTCATATGTCAGATTTGTTCAG-3¢for the 5¢-primer and 5¢-GGCCACTGGATCCAACTACAGCAATTCTCA-3¢ ... Engineering, Osaka University,2–1, Yamadaoka, Suita, Osaka 565–0871, Japan.Fax/Tel.: + 81 6 6879 7938; E-mail: kanaya@mls.eng.osaka-u.ac.jpAbbreviations: FKBP, FK506-binding protein; PPIase, peptidyl-prolylcis-trans...
  • 10
  • 436
  • 0
Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx

Báo cáo khoa học: Critical roles of conserved carboxylic acid residues in pigeon cytosolic NADP+-dependent malic enzyme docx

... decarboxy-lation activity of malic enzyme was assayed by the method of Tang & Hsu [38] using oxaloacetate as substrate. Therate of decarboxylation of oxaloacetate was measured bymonitoring the disappearance ... (QuantumSoft,Uetikon am See, Switzerland).Partial reaction analysisThe two partial activities of malic enzyme, decarboxylationand reduction, can be evaluated separately. The decarboxy-lation ... deprotonating the C2 hydroxy group toform an oxaloacetate intermediate and in facilitatingthe hydride transfer from C2 to NADP+. Afterdecarboxylation of oxaloacetate, a general acid partici-pates...
  • 10
  • 316
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ