Báo cáo toán học: " Population level risk assessment: practical considerations for evaluation of population models from a risk assessor''''''''s perspective" docx
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
... DNA AMPLIFIER MIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag- ments containing a complete x-5 gliadin gene, oligonucleo- tides, 5 ¢-AAGTGAGCAATAGTAAACACAAATCAAAC-3¢ and 5¢-CGTTACATTATGCTCCATTGACTAACAACGA TG-3¢, ... kit and the ABI 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). Expression and purification of recombinant protein Sense (5¢-ATTTCATATGCAACAACAATTCCCCCAGC...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... boundaries as hidden variables and include probabilities for let- ter transitions within segments. The ad- vantage of this model family is that it can learn from small datasets and easily gen- eralises ... probabilistically combine ParaMor (Monson, 2008) and Morfessor (Creutz, 2006). They used a natural language tagger which was trained on the output of ParaMor and Morfes- sor. The...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Keyword Extraction using Term-Domain Interdependence for Dictation of Radio News" ppt
... because of many noisy keywords. In our method, newspaper articles and units of radio news are classified into many domains. At each domain, a feature vector is calculated by an encyclopedia ... noun at each domain. We call the feature vector FeaVe. Each element of FeaVe is a X 2 value (Suzuki et al., 1997). Then, nouns are extracted from newspaper ar- ticles by a morp...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot
... a manner analogous to what has been shown for APP [50] and to what has been presented here for APLP1. As BACE1 did not alter the levels of APP, APLP1 and APLP2 mRNA, it would appear that BACE1 ... independent of genetic background (Fig. S5), and indicate that BACE1 is responsible for the generation of at least 20% of APLP2s. BACE1 manipulation alters the quantity and form o...
Ngày tải lên: 15/03/2014, 10:20
báo cáo hóa học: "Using hierarchical clustering methods to classify motor activities of COPD patients from wearable sensor data" pdf
... suited to small data sets. Each level of merging was trained and tested independently with a balanced set of data; i.e. a data set sampled equally from each class. 75% of samples in the data set were ... 6 ambulatory tasks: walking on a treadmill, level walking in a hallway, ascending/ descending stairs, and ascending/descending a ramp. Ambulatory Task Classification Res...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" The calcar screw in angular stable plate fixation of proximal humeral fractures - a case study" potx
... 8. Duda G, Epari D, Babst R, Lambert S, Matthys R, NP S: Mechanical evaluation of a new minimally invasive device for stabilization of proximal humeral fractures in elderly patients: a cadaver ... JM, Pajarinen J, Savolainen V: Internal fixation of proximal humeral fractures with a locking compression plate: a retrospective evaluation of 72 patients followed for a mi...
Ngày tải lên: 20/06/2014, 07:20
Tài liệu Báo cáo khoa học: "Reading Level Assessment Using Support Vector Machines and Statistical Language Models" pdf
... are inadequate due to their reliance on vocabulary lists and/or a superfi- cial representation of syntax. Our approach uses n- gram language models as a low-cost automatic ap- proximation of both ... a standard statistical parser (Charniak, 2000) to provide syntactic analysis. In practice, a teacher is likely to be looking for texts at a particular level rather than classif...
Ngày tải lên: 20/02/2014, 15:20
Báo cáo y học: "High level expression of apoptosis inhibitor in hepatoma cell line expressing Hepatitis
... 3’-GAGGAGACAGTCCTACTGAAA (API1) and 3’-CATAGCATTATCCTTCGGTTC (API2) were used to detect cIAP2. Primers with the sequence 3’-GGGAAGCAGAGATCATTTTGC (API3) and 3’- AACTGAGTATATCCATGTCCC (API4) ... Tsuda H, Hirasawa A, Miura M, Sakamoto M, Hirohashi S, Inazawa J. Expression of cIAP1, a target for 11q22 amplification, correlates with resistance of cervical cancers to radiotherapy. Canc...
Ngày tải lên: 02/11/2012, 11:17
Tài liệu Báo cáo khoa học: "Two-Level, Many-Paths Generation" docx
... to load non-traditional duties onto a generator, such as word sense disambiguation for machine translation. For example, bei in Japanese may mean either American or rice, and sha may mean shrine ... vh@cs.columbia.edu Abstract Large-scale natural language generation re- quires the integration of vast mounts of knowledge: lexical, grammatical, and concep- tual. A robust...
Ngày tải lên: 20/02/2014, 22:20
Báo cáo khoa học: "Text-level Discourse Parsing with Rich Linguistic Features" pdf
... individual instances rather than individual relation classes are not applicable. ased evaluation metrics in this task. Similar to Struc- ture classification, the accuracy on the training data (TAcc) 4 is ... experiments, all classi- fications are conducted and evaluated on the basis of individual instances. Each instance is of the form (S L , S R ), which is a pair of adjacent text sp...
Ngày tải lên: 07/03/2014, 18:20