... association between patient identified functional problems and responses to global measures of health in low back pain patients. Methods: Participants in a low back pain clinical trial were followed ... Access Research Testing a model of association between patient identified problems and responses to global measures of...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo toán học: " RFTraffic: a study of passive traffic awareness using emitted RF noise from the vehicles" docx
... as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. RFTraffic: a study of passive traffic awareness using emitted RF noise from the vehicles EURASIP ... requires a small amount of training data to estimate the parameters (means and variances of the variables) necessary for classification. In naive Ba...
Ngày tải lên: 20/06/2014, 20:20
... θ |I 1 |,|I 2 | x 2 . 6 Nea r optimal bound of orthogonal matching pursuit using restricted isometric constant Jian Wang, Seokbeop Kwon and Byonghyo Shim ∗ School of Information and Communication, ... formatted PDF and full text (HTML) versions will be made available soon. Near optimal bound of orthogonal matching pursuit using restricted isometric co...
Ngày tải lên: 20/06/2014, 20:20
Báo cáo toán học: " On transmission performance of OFDM-based schemes using MMSE-FDE in a frequencyselective fading channel" pot
... 2011:193 http://jwcn.eurasipjournals.com/content/2011/1/193 Page 3 of 10 RESEARCH Open Access On transmission performance of OFDM-based schemes using MMSE-FDE in a frequency- selective fading channel Haris Gacanin 1* and ... Channel capacity of OFDM/TDM using MMSE-FDE From here on, we analyze capacity of the OFDM/TDM using MMSE-FDE based on the assumptio...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo toán học: "Toward a characterization of reflexive contractions " pot
... h 2" alt =""
Ngày tải lên: 05/08/2014, 15:21
Báo cáo toán học: "On a System of Semilinear Elliptic Equations on an Unbounded Domain" potx
... C. Evans, Partial Diff. Equations, American Math. Society, 1998. 5. C. Vargas an d M. Zuluaga, On a Nonlinear Dirichlet Problem Type at Resonance and Bifurcation, Partial Differential Equations, ... Elliptic Equations on an Unbounded Domain Hoang Quoc Toan Fa culty of Math., Mech. and Inform. Vietnam National University, 334 Nguyen Trai, Hanoi, Vietnam Received Ma y 12, 2004...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán học: "On a Class of Constant Weight Codes" pptx
... follows that the polynomial P (X)=(X + x)(X + x)(X + y)(X + y) On a Class of Constant Weight Codes Mihai Caragiu Institute of Mathematics Bucharest and Department of Mathematics, Pennsylvania State ... of all the rows of the remaining matrix can be seen (by replacing each occurrence of a −1 with 0) as a nonlinear code of length n =4t −1havingaconstantweight[n/2] = 2t...
Ngày tải lên: 07/08/2014, 06:20
Báo cáo toán học: "On a theorem of Erd˝s, Rubin, and Taylor on o choosability of complete bipartite graphs" pptx
... ,|E|, assign to w i,j the list L(w i,j )=e j . the electronic journal of combinatorics 9 (2002), #N9 2 On a theorem of Erd˝os, Rubin, and Taylor on choosability of complete bipartite graphs Alexandr ... t-coloring of a hypergraph H is panchromatic if each of the t colors is used on every edge of G. Thus, an ordinary 2-coloring is panchromatic. Some results...
Ngày tải lên: 07/08/2014, 06:23
Báo cáo toán học: "On a class of hyperplanes of the symplectic and Hermitian dual polar spaces" doc
... lemma, we collect some the electronic journal of combinatorics 16 (2009), #R1 11 On a class of hyperplanes of the symplectic and Hermitian dual polar spaces Bart De Bruyn ∗ Department of Pure Mathematics ... 5 1A4 5, 5 1A5 0 Abstract Let ∆ be a symplectic dual polar space DW (2n−1, K) or a Hermitian dual polar space DH(2n − 1, K, θ), n ≥ 2. We define...
Ngày tải lên: 07/08/2014, 21:21
Báo cáo toán học: "On a problem of Marco Buratti" pps
... Buratti Peter Horak University of Washington Tacoma, WA 98402 horak@u.washington.edu Alexander Rosa McMaster University Hamilton, Ontario, Canada rosa@mcmaster.ca Submitted: Apr 9, 2008; Accepted: Jan 21, ... the sum of a j s must be at least as large as the g.c.d. (A J ) − 1 where A J contains q and all a i s that are not in J. The necessity of the above conditions can be shown...
Ngày tải lên: 07/08/2014, 21:21
Báo cáo toán học: "On a Generalization of Meyniel’s Conjecture on the Cops and Robbers Game" potx
... #P19 7 On a Generalization of Meyniel’s Conjecture on the Cops and Robbers Game Noga Alon ∗ Tel Aviv University and Institute for Advanced Study, Princeton nogaa@tau.ac.il Abbas Mehrabian Department ... 05C57 Abstract We consider a variant of the Cops and Robbers game where the robber can move s edges at a time, and show that in this variant, the co...
Ngày tải lên: 08/08/2014, 12:23
Báo cáo toán học: "On a Conjecture of Frankl and F¨redi u" doc
... discussions with Eva Czabarka, Ida Kantor, Gyula O.H. Ka t ona, Nathan Lemons, Bal´azs Patk´os, L´aszl´o Sz´ekely, and Jacques Verstra¨ete. The author thanks the NSF for funding her and IPAM for hosting ... University of California San Diego, La Jolla, CA, 92093, USA. E-mail: anchowdh@math.ucsd.edu the electronic journal of combinatorics 18 (2011), #P56 1 Frankl and F¨uredi [7] ve...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo sinh học: "In vitro activities of 18 antimicrobial agents against Staphylococcus aureus isolates from the Institut Pasteur of Madagascar" doc
... 1 of 5 (page number not for citation purposes) Annals of Clinical Microbiology and Antimicrobials Open Access Research In vitro activities of 18 antimicrobial agents against Staphylococcus aureus ... study was to make an update on the susceptibility of S. aureus isolates from the IPM to var- ious drugs and therefore to improve the empirical approaches to...
Ngày tải lên: 08/08/2014, 19:20
báo cáo khoa học: "Correction: A study of association between expression of hOGG1, VDAC1, HK-2 and cervical carcinoma" ppt
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot
... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG ... TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG AAGGAAACAAATGA AAAT TCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGG A...
Ngày tải lên: 12/08/2014, 03:20