Đăng nhập

Hãy chọn một cách để đăng nhập

Hoặc tiếp tục với email

Nhớ mật khẩu

Chưa có tài khoản? Đăng ký

Báo cáo toán học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" ppt

Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx

Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx

... and then M. Sakono et al. Formation of amyloid beta oligomers by prefoldin FEBS Journal 275 (2008) 5982–5993 ª 2008 The Authors Journal compilation ª 2008 FEBS 5989 Formation of highly toxic soluble ... of soluble Ab oligomers formed in the presence of PFD. Samples of Ab oligomers formed in the presence of PFD (Ab ⁄ PFD), Ab ﬁbrils formed in the...

Ngày tải lên : 07/03/2014, 04:20

12
385
0

Báo cáo Y học: Synthesis of phosphoenol pyruvate (PEP) analogues and evaluation as inhibitors of PEP-utilizing enzymes pot

Báo cáo Y học: Synthesis of phosphoenol pyruvate (PEP) analogues and evaluation as inhibitors of PEP-utilizing enzymes pot

... as inhibitors of the reaction betweenADPandPEPcatalysedbypyruvatekinase. Pyruvic acid is one of the products of this reaction. Therefore, activity was measured by coupling the formation of pyruvate ... Garcı ´ a-Alles and B. Erni (Eur. J. Biochem. 269) Ó FEBS 2002 Synthesis of phospho enol pyruvate (PEP) analogues and evaluation as inhibitors of PEP-util...

Ngày tải lên : 18/03/2014, 01:20

11
642
0

Báo cáo khoa học: Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiﬂorum pptx

Báo cáo khoa học: Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiﬂorum pptx

... Journal 272 (2005) 1660–1668 ª 2005 FEBS 1665 Synthesis of b-mannosides using the transglycosylation activity of endo-b-mannosidase from Lilium longiﬂorum Akiko Sasaki 1 , Takeshi Ishimizu 1 , ... Puriﬁcation of the b-N-acetylhexosaminidase from Aspergillus oryzae and the b-mannosidases from Helix pomatia and A. oryzae and their application to the enzymat...

Ngày tải lên : 30/03/2014, 16:20

9
576
0

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... S. litura and Amsacta albistriga polyhedrin genes (Acc# X94437 and AF118850 , respectively) and 85% with S. exigua and Malacosoma neustria polyhedrin gene (Acc# AF169823 ; AY127899 and AJ277555, ... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT 63 |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AcMNPV 1484 AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGG...

Ngày tải lên : 20/06/2014, 01:20

11
854
0

Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

... during the past decade, the extracellular deposits of beta- amyloid [A ] peptides forming plaques and the intracellular neurofibrillary tangles have been regarded as the major histopathological ... overnight incubation with a primary antibody (Abcam, Cambridge, MA, USA) was performed for the specific binding to A peptides on the HeLa cells. - 2 - Abstract The existence...

Ngày tải lên : 20/06/2014, 20:20

12
690
0

Báo cáo toán học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" ppt

Báo cáo toán học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" ppt

... EXPRESS Open Access Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet Wen-Hsiang Liao 1,2 , Da-Hua Wei 1,2* and Chii-Ruey ... of highly transparent ultrananocrystalline diamond films from a low-pressure, low- temperature focused microwave plasma jet. Nanoscale Re...

Ngày tải lên : 20/06/2014, 20:20

8
457
0

Báo cáo toán học: " Structure of reverse microemulsion-templated metal hexacyanoferrate nanoparticles" ppt

Báo cáo toán học: " Structure of reverse microemulsion-templated metal hexacyanoferrate nanoparticles" ppt

... method of the synthesis of metal hexacyanoferrate nanoparticles. Keywords: reverse micelles; template method; nanoparticles; nickel hexacyanoferrate. - 9 - the nanostructure of the ... size and size distribution. Furthermore, it was found that - 1 - Structure of reverse microemulsion-templated metal hexacyanoferrate nanoparticles Alberto Gutiérrez-Bec...

Ngày tải lên : 20/06/2014, 20:20

22
527
0

Báo cáo toán học: " Enhancement of the photoelectric performance of dye-sensitized solar cells by using Ag-doped TiO2 nanofiber in TiO2 nanoparticle film as an electrode" pot

Báo cáo toán học: " Enhancement of the photoelectric performance of dye-sensitized solar cells by using Ag-doped TiO2 nanofiber in TiO2 nanoparticle film as an electrode" pot

... h1a" alt =""

Ngày tải lên : 20/06/2014, 20:20

16
396
0

Báo cáo toán học: " Characterization of epitaxial GaAs MOS capacitors using atomic layer-deposited TiO2/Al2O3 gate stack: study of Ge auto-doping and p-type Zn doping" doc

Báo cáo toán học: " Characterization of epitaxial GaAs MOS capacitors using atomic layer-deposited TiO2/Al2O3 gate stack: study of Ge auto-doping and p-type Zn doping" doc

... formatted PDF and full text (HTML) versions will be made available soon. Characterization of epitaxial GaAs MOS capacitors using atomic layer-deposited TiO2/Al2O3 gate stack: study of Ge auto-doping and p-type ... Figure 2 presents the ToF-SIMS profile of the epitaxial GaAs/ Ge interface for undoped and Zn- doped epi -GaAs with ALD coated TiO...

Ngày tải lên : 20/06/2014, 20:20

19
694
0

Báo cáo toán học: "Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt" pot

Báo cáo toán học: "Identification of mosquito larvicidal bacterial strains isolated from north Sinai in Egypt" pot

... fragments of Bin A genes encoding 42-kDa toxin of local strains of B. sphaericus. Figure 3. Phylogenetic trees of the DNA fragments of Bin B genes encoding 51-kDa toxin of local strains of B. ... locally isolated strains 3 The toxicity of B. sphaericus strains is mainly attributed to the presence of binary toxin (Bin A, Bin B) and/or mosquitocidal (Mtx) toxin...

Ngày tải lên : 20/06/2014, 20:20

33
317
0

Báo cáo toán học: " Synthesis and anti-HSV-1 evaluation of new " docx

Báo cáo toán học: " Synthesis and anti-HSV-1 evaluation of new " docx

... (1a–k), and new three 3H-pyrido[2,3-b]pyrazolo[3,4-h]- 1,6-naphthyridine derivatives (2a–c). 1 Synthesis and anti-HSV-1 evaluation of new 3H-benzo[b]pyrazolo[3,4-h]- 1,6-naphthyridines and 3H-pyrido[2,3-b]pyrazolo[3,4-h]-1,6- naphthyridines ... acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Synthesis and anti-HSV-1 eval...

Ngày tải lên : 20/06/2014, 20:20

24
433
0

Báo cáo toán học: " Synthesis and characterization of CuO nanowires by a simple wet chemical method" pdf

Báo cáo toán học: " Synthesis and characterization of CuO nanowires by a simple wet chemical method" pdf

... Synthesis and characterization of CuO nanowires by a simple wet chemical method Anita Sagadevan Ethiraj 1 and Dae Joon Kang* 1 1 BK21 Physics Research Division, Department of Energy ... Fully formatted PDF and full text (HTML) versions will be made available soon. Synthesis and characterization of CuO nanowires by a simple wet chemica...

Ngày tải lên : 20/06/2014, 21:20

12
639
0

Báo cáo hóa học: " Synthesis and highly visible-induced photocatalytic activity of CNT-CdSe composite for methylene blue solution" pdf

Báo cáo hóa học: " Synthesis and highly visible-induced photocatalytic activity of CNT-CdSe composite for methylene blue solution" pdf

... Access Synthesis and highly visible-induced photocatalytic activity of CNT-CdSe composite for methylene blue solution Ming-Liang Chen and Won-Chun Oh * Abstract Carbon nanotube-cadmium selenide (CNT-CdSe) composite ... 2010, 22:2231-2243. doi:10.1186/1556-276X-6-398 Cite this article as: Chen and Oh: Synthesis and highly visible-induced photocatalytic...

Ngày tải lên : 21/06/2014, 03:20

8
353
0

Báo cáo hóa học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" docx

Báo cáo hóa học: " Synthesis of highly transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet" docx

... of highly transparent ultrananocrystalline diamond films from a low-pressure, low- temperature focused microwave plasma jet. Nanoscale Research Letters 2012 7:82. Liao et al. Nanoscale Research ... transparent ultrananocrystalline diamond films from a lowpressure, low-temperature focused microwave plasma jet Wen-Hsiang Liao 1,2 , Da-Hua Wei 1,2* and...

Ngày tải lên : 22/06/2014, 00:20

8
311
0

Báo cáo toán học: "† Pairs of disjoint q-element subsets far from each other" pot

Báo cáo toán học: "† Pairs of disjoint q-element subsets far from each other" pot

... G 0 =(V,E 0 )andG 1 =(V,E 1 )thatsatisfytherequirementsof Theorem 1.3. The vertex set V consists of the q-element subsets of X, |V | =  n q  = N. Two q-element subsets are adjacent in G 0 if their intersection is empty, while two q-element subsets ... Y 1 be the set of all disjoint pairs {A, B} of q-element subsets of an n-element X. δ 1 ({A 1 ,B 1 }, { A 2 ,B...

Ngày tải lên : 07/08/2014, 06:23

7
216
0

Từ khóa: