báo cáo hóa học:"Valuation of scleroderma and psoriatic arthritis health states by the general public" docx

báo cáo hóa học:"Valuation of scleroderma and psoriatic arthritis health states by the general public" docx

báo cáo hóa học:"Valuation of scleroderma and psoriatic arthritis health states by the general public" docx

... not the case. In other words, to the general public, the extent of skin thickening does not significantly affect the value of SSc health states. This finding may due to the way the health states ... description of PsA and SSc health states (Appendix) and asked to imagine how it would be to spend the rest of their life in that health state. We developed...

Ngày tải lên: 20/06/2014, 16:20

9 341 0
báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

... inhibitory effects of PGSE and the mixture of ginsenosides, we measured the percentage change of TNF-α induced-CXCL-10 mRNA after the pretreatment of 3 mg/ml of PGSE, or the mixture of ginsenosides ... normalized with the total intensity of all genes from the genechip, and then the normalized signal of each treatment was compared with the mock-treatment to...

Ngày tải lên: 18/06/2014, 15:20

10 500 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

... by ISH and the expression levels of IGF2-P4 and H19 transcripts were determined by the intensity of the hybridization signal and by the quantity of the stained cells. Table 3 shows that out of ... CAGCAATGCAGCACGAGGCGAAGCC) was designed to bind the 3’ end of exon 7 and the 5’ end of exon 8 without the introns in betwe en. The integrity of the cD...

Ngày tải lên: 18/06/2014, 16:20

18 746 0
báo cáo hóa học: " Valuation of transfusion-free living in MDS: results of health utility interviews with patients" ppt

báo cáo hóa học: " Valuation of transfusion-free living in MDS: results of health utility interviews with patients" ppt

... aspects of health were nor- mal. They were then asked to place the health states at any point on the scale to correspond to their preferences for these health states. The TTO part of the interview ... state and the period of perfect health on offer, a utility score was assigned to the MDS state by estimating the ratio of the time in perfect health on o...

Ngày tải lên: 18/06/2014, 19:20

8 497 0
báo cáo hóa học: " Quality of care and health-related quality of life of climacteric stage women cared for in family medicine clinics in Mexico" pot

báo cáo hóa học: " Quality of care and health-related quality of life of climacteric stage women cared for in family medicine clinics in Mexico" pot

... would help in defining the standards of care at the local level. The implementation of standards of care and evaluation activities should be tailored to the characteristics of the services that are ... description In each FMC, the nurse identified candidates in the waiting room, explained the purpose of the study and of the interview, and asked for her si...

Ngày tải lên: 18/06/2014, 19:20

12 451 0
báo cáo hóa học: " Impact of schizophrenia and schizophrenia treatment-related adverse events on quality of life: direct utility elicitation" pot

báo cáo hóa học: " Impact of schizophrenia and schizophrenia treatment-related adverse events on quality of life: direct utility elicitation" pot

... the design and valida- tion of the health states for the TTO, and the design of the study protocol: Professor Bill Deakin from the University of Manchester, UK; Professor George Awad from the ... quality of life and relapse and EPS the greatest impact on quality of life, indicating as clear an understanding by patients of the health states an...

Ngày tải lên: 18/06/2014, 19:20

9 394 0
Báo cáo hóa học: " Effects of obesity and chronic low back pain on gait" docx

Báo cáo hóa học: " Effects of obesity and chronic low back pain on gait" docx

... of step for Kinematics (degrees) HFE-ROM the range of motion at hip joint on the sagittal plane during the gait cycle, calculated as the difference between the maximum and minimum values of the ... this phase of gait cycle KFE-ROM the range of motion at knee joint (on the sagittal plane) during the gait cycle, calculated as the difference between the maximum...

Ngày tải lên: 19/06/2014, 08:20

7 379 0
báo cáo hóa học: "Improvement of diaphragm and limb muscle isotonic contractile performance by K+ channel blockade" pdf

báo cáo hóa học: "Improvement of diaphragm and limb muscle isotonic contractile performance by K+ channel blockade" pdf

... of the study, participated in the design of the study, participated in the data analysis, and participated in writing the manuscript. JP participated in the design of the study, carried out the ... data; in the writing of the manuscript; and the decision to submit the manuscript for publication. These studies were supported by grants from the Department...

Ngày tải lên: 19/06/2014, 08:20

9 389 0
báo cáo hóa học: "Effect of obesity and low back pain on spinal mobility: a cross sectional study in women" pptx

báo cáo hóa học: "Effect of obesity and low back pain on spinal mobility: a cross sectional study in women" pptx

... understanding of the relationships between function and the onset of clinical symptoms. Purpose: to objectively assess the posture and function of the spine during standing, flexion and lateral ... recruitment of obese patients, study design and gave final approval to the version of the manuscript to be submitted. All the authors approved the final version o...

Ngày tải lên: 19/06/2014, 08:20

8 602 0
báo cáo hóa học: " Sensation of presence and cybersickness in applications of virtual reality for advanced rehabilitation" docx

báo cáo hóa học: " Sensation of presence and cybersickness in applications of virtual reality for advanced rehabilitation" docx

... and Evaluation of Biosignals associated with Presence and Cybersickness Mismatch between the visual and vestibular systems can disturb the autonomic nervous regulation and lead to symptoms of ... measured, there is the limitation of ANA-related indices estimated from meas- ured biosignals. Then, the questionnaire was often used as a subjective index. A certain level of...

Ngày tải lên: 19/06/2014, 10:20

5 258 0
w