báo cáo hóa học:" Interpretation of response categories in patient-reported rating scales: a controlled study among people with Parkinson''''''''s disease" pot

... effec- tive than MI or functional training alone [18]. However, Sharma [12] has pointed out that MI training alone pro- duces less improvement than functional training. An advantage of MI is that patients ... database search, Jan Kool, Martina Spiess and Cornelia Barth for critical remarks and Katharina Schlatter and Arianne Knüsel for English corrections. References 1. World OH: The Atla...

Ngày tải lên: 19/06/2014, 10:20

... used, except in one case where also methamphetamine had been taken. A combination of methamphetamine and diazepam was found in two samples. In those cases, amphetamine was also detected as a metabolite of ... the study and interpreting the data. BY had the main responsibility for planning and coordinating the acquisition of data. HG had the main responsibility for drafting t...

Ngày tải lên: 20/06/2014, 00:20

... not separated into stages 4 and 4S since 4S is for infants INSS (International Neuroblastoma Staging System) according to Simpson and Gaze [27] at autopsy Journal of Translational Medicine 2009, ... was analyzed by MS. RC contributed with data interpretation and drafting of the manuscript written by DF and FA. EL and MS provided input in writing of the manuscript. All authors re...

Ngày tải lên: 18/06/2014, 15:20

... Pouchitis and extraintestinal manifestations of inflammatory bowel disease after ileal pouch-anal anastomosis. Ann Surg 1990, 211(5):622-629. 15. Hata K, Watanabe T, Shinozaki M, Nagawa H: Patients with ... fact that both inflammatory and apoptosis pathways are related. Furthermore, the major pathway of apoptosis in these cases were intrinsic mitochondrial pathway char- acterized by A...

Ngày tải lên: 18/06/2014, 16:20

... Utrophin was taken from Arning et al. [29] (Forward 5' aaggacctggtcaacgttcca 3', Reverse 5' acccgtgtcatagacattgagca 3'). The Beta-Actin mRNA level was used as control for normalization ... normalization of samples (For- ward 5#8242; gacaggatgcagaaggagattact 3', Reverse 5#8242; tgatccacatctgctggaaggt 3'). Nothern Blot analysis Given the limited amount of RNA a...

Ngày tải lên: 18/06/2014, 16:20

... Rowland CR, Jirgens KJ, Gomez-Mancilla B: Treatment satisfaction, functional status, and health-related quality of life of migraine patients treated with almotriptan or sumatriptan. Clinical Therapeutics ... Row- land CR: Validation of a general measure of treatment satis- faction, the Treatment Satisfaction Questionnaire for Medication (TSQM), using a national panel study of...

Ngày tải lên: 18/06/2014, 18:20

... contributed substantially to study design, data collection, analysis of data and preparation of the manuscript. All authors have also read and approved the final manuscript. Acknowledgements The authors ... Faculty of Medical Sciences Ethics Commit- tee. Statistical approach All data were initially captured into Epidata ® for Windows and then analyzed with Stata™ statistical softwa...

Ngày tải lên: 18/06/2014, 19:20

... found Visual analogue scale ratings of symptoms present during a flareFigure 3 Visual analogue scale ratings of symptoms present during a flare. A box plot of the VAS ratings of symptoms present during ... UC disease activity indices are rarely Visual analogue scale ratings of symptoms that are absent during remissionFigure 5 Visual analogue scale ratings of symptoms that a...

Ngày tải lên: 18/06/2014, 19:20

... the approach does not require a large amount of samples for training, as the back-propagation neural network approach proposed in [17]. Standard parameters used to evaluate the performance of the ... hypothesis that cardiac rate can be estimated more easily by spectral analysis than time domain analy- sis, techniques in the frequency domain have been widely investigated as alternati...

Ngày tải lên: 19/06/2014, 10:20

... an increase in VF size of 5 – 7°. Reading training had a similar effect: In 34% of hemianopic patients who participated in read- ing training, an average VF enlargement of 5.4° was obtained after ... 2 Treatment algorithm. Section of the visual field of a patient including an area of intact (dotted) and anopic (light shading) vision. The "treatment area" (dark...

Ngày tải lên: 19/06/2014, 10:20