báo cáo hóa học:" The positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population" pdf
... mental health. The World Health Organisation states that health is a state of complete physical, mental and social well-being and not merely the absence of disease or infirmity and mental health ... validation of a culturally relevant scale in a multi-ethnic asian population Janhavi Ajit Vaingankar 1*† , Mythily Subramaniam 1† , Siow Ann Chong...
Ngày tải lên: 20/06/2014, 15:20
... constitutes constantly changing cognitive, behavioural and emo- tional efforts to manage particular external and/ or inter- nal demands that are appraised as taxing or exceeding the resources of the individual ... items included in any scale were included in the study. Results The total mean and standard deviation of trait anxiety in two types of diabetes was 46.98...
Ngày tải lên: 18/06/2014, 19:20
... between change in visual acuity defined as a con- tinuous variable and change in the VFQ-25 scales, controlling for age, gender, and visual acuity at baseline. In all models, except the one with the ... ocular pain subscale as the dependent variable, change in visual acuity was significantly associated with change in the VFQ-25 scale (p < 0.0001). Baseline visua...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot
... citation purposes) had a somewhat larger percentage of Caucasian patients. The change analysis sample was primarily male (64.1%) and Caucasian (81.9%), with a mean age of 59.3 years. This sample ... the change group is a five-level inde- pendent variable. Age and baseline visual acuity are continuous covariates, and gender is a categorical covari- ate. The dependent va...
Ngày tải lên: 20/06/2014, 16:20
báo cáo hóa học: " The Psychosocial Screen for Cancer (PSSCAN): Further validation and normative data" pptx
... established criterion measure, namely the HADS subscales, a criterion of 8 or above on the HADS Anxiety Scale was taken as an indication of a subclinical diagnosis and a criterion of 11 or above ... differ in health status. Sample 1 was the large sample (n = 570) of cancer patients described in the original manuscript [10]. Sample 2 was a small in- patient s...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " The molecular dynamic simulation on impact and friction characters of nanofluids with many nanoparticles system" pot
... had a small deformation, and with larger one in case 2, the nanoparticle was squashed and large deformation had been made. In the meantime of press- ing nanoparticle, distribution of atoms in ... m/s; the velocity of nano- particles in lower layer is much lower than that of nanoparticles in upper layer, and the main reason might be the absorption force of...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo Y học: The sodium pump Its molecular properties and mechanics of ion transport potx
... or cardiac glycosides, such as ouabain and digitalis. Other substances, like palytoxin from marine corals of the genus Palythoa or sanguinarine from the plant Sanguinaria canadensis, are also ... understanding the translocation process, or at least in gaining some room for speculation. The Kdp-ATPase of bacteria is a particularly interesting K + -transporting ATPase made up...
Ngày tải lên: 24/03/2014, 00:21
báo cáo hóa học:" Gene expression profiling for molecular distinction and characterization of laser captured primary lung cancers" ppt
... covering 8793 genes, and stained according to the manufacturer's instructions. Quantification, normalization and statistical analysis The quality control, normalization and data analysis, ... cell contact and tumor spreading. The extracellular cell matrix receptors integrin alpha-3 and integrin beta-2 as well as the collagen binding protein-1 (SERPHINH1) were upregulate...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Research Article Novel Data Fusion Method and Exploration of Multiple Information Sources for " ppt
... CCAAATAAGG, GCCCATGTAAGGAG, GAAACGCCATATAAGGAGCAGG, GCAGCGCCTTATATGGAGTGGC, CTCCAAATTTAGGC, TGCTTCCCATATATGGCCATGT, CCATATTAGG, CTATTATGG TBP 1 (C)TATAAA (A) , TACAAAT, TTAAA, ATAAATA, TTAAAT, TATAAG TCF1 1 GTTATTGGTTAAAGAAGTATA, GTGTAGGTTACTTATTCTCCTTTTGTTGA TEAD1 ... GTTATTGGTTAAAGAAGTATA, GTGTAGGTTACTTATTCTCCTTTTGTTGA TEAD1 2 (AA)CATTCCTT(CGG), AGGAGGAATGTGC TRP53 2 GAGCAAGTCA, ATACAAGGCC...
Ngày tải lên: 21/06/2014, 08:20
Báo cáo hóa học: "Research Article Minimal Nielsen Root Classes and Roots of Liftings" pptx
... homotopy invariant, and it is independent of the selected point a ∈ Y , provid that Y is a manifold. In this case, there is no danger of ambiguity in denot it by Nf. In a similar way as in the previous ... lifting through some covering space and not having all Nielsen root classes with minimal cardinality. In this section, we study the relationship between the...
Ngày tải lên: 21/06/2014, 20:20