báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... Dr. Irina Kerkis for anti- bodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures. Mrs. Constancia Urbani for secretarial assistance. FAPESP/CEPID, ... discarded in surgical procedures Tatiana Jazedje 1 , Paulo M Perin 2 , Carlos E Czeresnia 3 , Mariangela Maluf 2 , Silvio Halpern 2 , Mariane Secco 1 , Daniela F Bueno 1 , Natassia M V...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... prior data indicating an interaction between this viral protein and hsp90 [26,30] raises the possibility that geldanamycin may have antivi- ral activity against influenza A as well as a variety ... introduced, the ratios of cRNA to mRNA and vRNA to mRNA changed by around 8 fold across the temperature range. When a cRNA-like CAT RNA was transfected the cRNA:mRNA ratio decreased...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
... Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... longicornis Neumann (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Northeastern China and USSR, and its parthenogenetic and bisexual popula- tions (Ixodoidea,...
Ngày tải lên: 16/03/2014, 10:20
báo cáo hóa học:" Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors" docx
... treatment of malignant brain tumors Hemant Sarin Address: National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health, Bethesda, Maryland, USA Email: Hemant Sarin ... malignant brain tumor microvasculature is approximately 12 nanometers. Spherical nanoparticles ranging between 7 nm and 10 nm in diameter maintain peak blood concentrations for several hours and...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Occupational risk of overweight and obesity: an analysis of the Australian Health Survey" pptx
... smoked at least 100 cigarettes and information about ages they had started and ceased smoking. Data handling and statistical analysis The weighting factors for each record were computed by the ABS ... significantly lower mean BMI is found in managers and administrators, professional and associate professional, advanced clerical and service workers and intermediate and elementary sales a...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" What do standard radiography and clinical examination tell about the shoulder with cuff tear arthropathy?" docx
... para- meters as well as the total Constant score and all radi- ological parameters cited above are analysed. Statistical analysis was performed with R (a language and environment for statistical computing) ... Coordinating; providing data; providing study idea; writing the article. All authors have read and approved the final manuscript. Competing interests The authors declare that t...
Ngày tải lên: 20/06/2014, 07:20
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ... 4653 Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro Sakai...
Ngày tải lên: 20/02/2014, 02:21
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc
... 24660–24664. 9 Lu CT, Tada T, Nakamura Y, Wada K, Nishimura K, Katsuya Y, Sawada M, Takao M & Sakai T (2000) Crystallization and preliminary X-ray analysis of endo- polygalacturonase SE1 from Trichosporon ... mole- cule mainly consists of (partly methylated) homogalac- turonan, interspersed with rhamnogalacturonan units, which often contain sugar side chains composed of arabinan and gal...
Ngày tải lên: 20/02/2014, 03:20
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
... Adenocarcinomas and Barrett’s Esophagus Esophageal adenocarcinoma is an entity of increasing clinical importance, due to an unexplained incidence rise among white males in the Wester n world [1], and a dismal ... one of the six ‘hall- marks of cancer’ , initially described by Hanahan and Weinberg [28,29]. Invasive and metastatic capabilities are largely mediated by extracellular p...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese ... quite large interval also encompasses o ther immune-relevant genes such as IL15RA, and the authors could not pin-point the causal variant with the locus [28]. The genetic interval was...
Ngày tải lên: 18/06/2014, 16:20