báo cáo hóa học:" Decomposition of sources of income-related health inequality applied on SF-36 summary scores: a Danish health survey" pptx
báo cáo hóa học: "Performance adaptive training control strategy for recovering wrist movements in stroke patients: a preliminary, feasibility study" pptx
... Background Decreased wrist range of motion (ROM) (flexion and/or extension, abduction/adduction or pronation/supina- tion) after trauma or surgery can be a challenging problem. Physica l therapy, ... understand an d follow instructions; 3) chronic condition (at least 1 year after stroke). Table 3 summarizes the anagraphic data (age, sex) and the clini cal state (eti ology, disease duratio...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Astrogliosis is delayed in type 1 interleukin-1 receptor-null mice following a penetrating brain injury" pptx
... two glutamate transporters, glutamate aspartate transporter (GLAST) and glutamate transporter-1 (GLT-1/EAAT2), the glutamate transaminase, glutamine synthetase (GS) and the calcium regulatory protein ... mice indicate that abrogating IL-1R1 signaling delays some responses of astroglial activation; however, many of the important neuroprotective adaptations of astrocytes to brain trauma a...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo khoa học: "Lexical Disambiguation: Sources of Information and their Statistical Realization" docx
... Lexical Disambiguation: Sources of Information and their Statistical Realization Ido Dagan * Computer Science Department, Technion, Haifa, Israel and IBM Scientific Center, Technion City, Haifa, ... City, Haifa, Israel Abstract Lexieal disambiguation can be achieved using differ- ent sources of information. Aiming at high perfor- mance of automatic disambiguation it is impo...
Ngày tải lên: 17/03/2014, 08:20
báo cáo hóa học:" Anti-angiogenic effect of high doses of ascorbic acid" pptx
... Effects of high dose ascorbic acid on angiogenesis The effect of ascorbic acid on capillary tube formation was analyzed for varying high concentrations of AA. In humans, these high-concentrations of ... of AA can be achieved only by intravenous administration of AA. The pharma- cokinetics of high concentrations of AA has been summa- rized in research paper [11]. Pharmacoki...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... Eiichi Hara - hara@cancer-c.pref.saitama.jp; Makoto Mitsunaga - mit@jikei.ac.jp; Yoshihisa Namiki - yoshihisan@jikei.ac.jp; Akitaka Takahara - akitaka-8-18@jikei.ac.jp; Eijiro Nagasaki - nagasaki@jikei.ac.jp; ... Ministry of Education, Cultures, Sports, Science and Technology of Japan, Grant-in-Aid of the Japan Medical Association, Takeda Science Foundation, Pancreas Research Founda...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
... vaccinated healthy donors. WB from donors naïve or vaccinated with HBsAg was incubated o/n in the presence of a 2 μg/ ml concentration of HBsAg. Following addition of RNAlater, total cellular RNA ... inad- equate, if at all available. In this work our aim was to design and test a RT-PCR based technique easily amenable to standardization and automation for the monitoring of cellul...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5'- TCGTTCCCAATCCCAAGGTA-3'. The rat GAPDH tran- script was measured for each sample ... 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaque nucleotide sequence (Genbank Acces- sion # BV209042). Human ABCA1...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Enhanced serum concentrations of transforming growth factor-beta1 in simple fatty liver: is it really benign?" pot
... Domenico Chianese - scopacasa@unina.it; Fabrizio Pasanisi - pasanisi@unina.it; Franco Contaldo - contaldo@unina.it; Francesco Scopacasa - scopacasa@unina.it; Domenico Capone - docapone@unina.it * ... Italy Email: Giovanni Tarantino* - tarantin@unina.it; Paolo Conca - paolo.conca@unina.it; Antonio Riccio - riccio@unina.it; Marianna Tarantino - tarantin@unina.it; Matteo N Di Minno - diminno@...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Effective transvascular delivery of nanoparticles across the blood-brain tumor barrier into malignant glioma cells" docx
... Wilson - wilsoncm@mail.nih.gov; Kamal Sharma - kamal.sharma@fda.hhs.gov; Maria A Aronova - aronovaa@mail.nih.gov; Richard D Leapman - leapmanr@mail.nih.gov; Gary L Griffiths - griffithsgl@mail.nih.gov; ... Magnevist dynamic scan data. Dynamic contrast-enhanced MRI data analyses and pharmacokinetic modeling Imaging data was analyzed using the Analysis of Func- tional NeuroImaging (AFNI;...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Phase II trial of Modified Vaccinia Ankara (MVA) virus expressing 5T4 and high dose Interleukin-2 (IL-2) in patients with metastatic renal cell carcinoma" pot
... SM, Naylor S, Melcher A, Nicholls J, Wassan H, Habib N, Anthoney A: Vaccination of colorectal cancer patients with modified vaccinia ankara encoding the tumor antigen 5T4 (TroVax) given alongside ... response to antigen was ≥ 10. A positive response was also required to demonstrate ≥ 2 fold increase after vaccination. Pheno- typic characterization was done by four color flow cytom- etry...
Ngày tải lên: 18/06/2014, 15:20