báo cáo hóa học:" Health-related quality of life following a clinical weight loss intervention among overweight and obese adults: intervention and 24 month follow-up effects" docx
báo cáo hóa học:" Health-related quality of life following a clinical weight loss intervention among overweight and obese adults: intervention and 24 month follow-up effects" docx
... and
behavioral counseling among adults that are not severely
overweight as this may be more typical of how we might
treat the majority of overweight and obese adults.
Health and Quality of Life ... end of the intervention and remained at greater
Changes in physical health-related quality of life (MOS SF-36)Figure 2
Changes in physical health-related qu...
báo cáo hóa học: " Does quality of life among breast cancer survivors one year after diagnosis differ depending on urban and non-urban residence? A comparative study" potx
... Atlanta:
American Cancer Society, Inc 2008.
2. Australian Institute of Health and Welfare (AIHW), Australasian Association
of Cancer Registries (AACR): Cancer in Australia: An overview, 2006.
Canberra: ... general
measure. J Clin Oncol 1993, 11(3):570-579.
29. Australian Bureau of Statistics (ABS): Australian Standard Classification of
Occupations. Canberra: ABS 1997.
30. Australian...
báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot
... Access
Research
Enhancing quality of life in older adults: A comparison of muscular
strength and power training
Jeffrey A Katula*
†
, W Jack Rejeski and Anthony P Marsh
Address: Department of Health & ... types of resistance training and a
control on changes in measures of quality of life and self-
efficacy in older adults. The data indicate that the m...
Báo cáo hóa học: " Do quality of life, participation and environment of older adults differ according to level of activity?" pdf
... Measure of the Quality of the Environment. Analysis of variance
(ANOVA) or Welch F-ratio indicated if the main variables differed according to activity level.
Results: Quality of life and satisfaction ... levels of activity limitations (none, slight to moderate and moderate to severe). Quality of
life was estimated with the Quality of Life Index, participation...
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx
... purposes)
Journal of Orthopaedic Surgery and
Research
Open Access
Research article
Osteoarthritis: quality of life, comorbidities, medication and health
service utilization assessed in a large sample of ... participated in the study design. All
authors read and approved the final manuscript.
Acknowledgements
This study is part of the PRAXART project that aims to improve t...
báo cáo hóa học:" Better quality of life with neuropsychological improvement on HAART" doc
... increase a person's ability to achieve and main-
tain a level of overall functioning necessary to decrease
substance abuse and increase overall physical health. The
identifying of factors that ... group and HAART failure group) by using t tests
and an alpha level of 0.05. Next, HAART treatment and
results on the NeuroQol were compared between groups
(HAART success gro...
báo cáo hóa học: " The burden of multiple sclerosis: A community health survey" pot
... 2G4, Canada,
2
Institute of Health Economics,
Edmonton, Alberta, T5J 3N4, Canada and
3
Faculty of Medicine and Dentistry, University of Alberta, Edmonton, Alberta, T6G 2G3, Canada
Email: C Allyson ... were also assessed using
ANCOVA, with adjustment for age, sex, education, marital
status, and social assistance as a source of income.
Sampling weights were applied to all ana...
báo cáo hóa học:" The occurrence of osteoarthritis at a minimum of ten years after reconstruction of the anterior cruciate ligament" pdf
... score,
KT-1000 stabilometry) and a radiological evaluation (Kellgren and Fairbanks classification).
Results: The patients' satisfaction, at a mean of 10,3 year follow-up, measured with a VAS score
(0–10) ... (Table 3
and 4)
The Fairbank classification showed an increase in osteoar-
thritis of 1 grade in 52% of the patients, 35% of the
patients had an increase of 2...
Báo cáo hóa học: " Self-excision of the BAC sequences from the recombinant Marek''''s disease virus genome increases replication and pathogenicity" doc
... detection of a 3.5-kb product by PCR
using primer pairs Us2-F (5'-GGAATACATTCGAGCG-
CAA) & Us7-R (5'-CTATAGACCAGATGCCTCGAA)
located in the Us2 and Us7 respectively. The Kan cassette
flanked ... sequence was amplified from
the wtRB-1B virus-infected chicken embryo fibroblasts
(CEF) genomic DNA by PCR using primers Us2F (5'-
GTTAATTAA
CGACAGACCTACTTGCTACCA) and Us3R
(...
Báo cáo hóa học: " The evolution of human influenza A viruses from 1999 to 2006: A complete genome study" docx
... the
paper. LPN and AF contributed reagents and materials.
AFO supervised the research. Further LPN and AF critically
revised the manuscript and AF gave the final approval for
publication. All authors ... http://www.virologyj.com/content/5/1/40
Page 12 of 19
(page number not for citation purposes)
(A) Seasonal amino acid distances of H3N2 HA and NA proteins since 1999 and (B)...