báo cáo hóa học:" Health-related quality of life in urban surgical emergency department patients: Comparison with a representative German population sample" docx

báo cáo hóa học:" Health-related quality of life in urban surgical emergency department patients: Comparison with a representative German population sample" docx

báo cáo hóa học:" Health-related quality of life in urban surgical emergency department patients: Comparison with a representative German population sample" docx

... purposes) Health and Quality of Life Outcomes Open Access Research Health-related quality of life in urban surgical emergency department patients: Comparison with a representative German population sample Bruno ... of life in young ED patients with minor trauma in comparison to a representative German popu- lation sample. Physical quali...
Ngày tải lên : 20/06/2014, 15:20
  • 9
  • 410
  • 0
báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot

... measures of quality of life and self- efficacy in older adults. The data indicate that the mode of training resulted in a differential pattern of change. Whereas the PT condition resulted in increases ... study included a global measure of quality of life, the satisfac- tion with life scale [20], a satisfaction index specific to physical functioning [21], an...
Ngày tải lên : 18/06/2014, 19:20
  • 8
  • 550
  • 0
báo cáo hóa học: " Does quality of life among breast cancer survivors one year after diagnosis differ depending on urban and non-urban residence? A comparative study" potx

báo cáo hóa học: " Does quality of life among breast cancer survivors one year after diagnosis differ depending on urban and non-urban residence? A comparative study" potx

... Atlanta: American Cancer Society, Inc 2008. 2. Australian Institute of Health and Welfare (AIHW), Australasian Association of Cancer Registries (AACR): Cancer in Australia: An overview, 2006. Canberra: ... general measure. J Clin Oncol 1993, 11(3):570-579. 29. Australian Bureau of Statistics (ABS): Australian Standard Classification of Occupations. Canberra: ABS 1997. 30. Australian...
Ngày tải lên : 18/06/2014, 19:20
  • 10
  • 425
  • 0
Báo cáo hóa học: " Do quality of life, participation and environment of older adults differ according to level of activity?" pdf

Báo cáo hóa học: " Do quality of life, participation and environment of older adults differ according to level of activity?" pdf

... environment with the Measure of the Quality of the Environment. Analysis of variance (ANOVA) or Welch F-ratio indicated if the main variables differed according to activity level. Results: Quality of life ... WHO: International Classification of Functioning, Disability and Health WHO: Geneva, Switzerland; 2001. 2. Asakawa T, Koyano W, Ando T, Shibata H: Effects of functio...
Ngày tải lên : 18/06/2014, 22:20
  • 11
  • 408
  • 0
báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx

báo cáo hóa học:" Osteoarthritis: quality of life, comorbidities, medication and health service utilization assessed in a large sample of primary care patients" potx

... according to most guidelines, was only marginally prescribed. The main pillar in pharmaco- logical treatment are NSAIDs such as Diclofenac [29-31]. This is in accordance with the fact that NSAIDs are ... Sex differences in musculoskeletal pain in older adults. Pain 2005, 116:332-338. 10. Thomas E, Peat G, Harris L, Wilkie R, Croft PR: The prevalence of pain and pain interference...
Ngày tải lên : 20/06/2014, 00:20
  • 9
  • 413
  • 0
báo cáo hóa học:" Better quality of life with neuropsychological improvement on HAART" doc

báo cáo hóa học:" Better quality of life with neuropsychological improvement on HAART" doc

... have failed HAART in order to increase a person's ability to achieve and main- tain a level of overall functioning necessary to decrease substance abuse and increase overall physical health. ... Stellbrink HJ, Barker C: Quality of life out- comes of combination zalcitabine-zidovudine, saquinavir- zidovudine, and saquinavir-zalcitabine-zidovudine therapy for HIV-infected a...
Ngày tải lên : 20/06/2014, 15:20
  • 7
  • 359
  • 0
Báo cáo hóa học: " Editorial Quality of Service in Mobile Ad Hoc Networks" ppt

Báo cáo hóa học: " Editorial Quality of Service in Mobile Ad Hoc Networks" ppt

... sixth paper by Nagaraja Thanthry et al. analyzes var- ious parameters that a ect the performance of TCP in an ad hoc network environment. Congestion and path nonavail- ability are two major factors ... transmitting RTS/CTS is also adjustable according to the power level for DATA/ACK packets. In this paper, the perfor- mance of APCMP protocol is evaluated by simulation and is compared...
Ngày tải lên : 22/06/2014, 22:20
  • 3
  • 305
  • 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC- CGGGTTTATTTCCTAAAAT GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG- GAAATGTTGAATACTCA TACTCTTCCTTTTTC-3'. The linear PCR-generated frag- ments were electroporated into YEbac102, ... pCR2.1 (Invitrogen) using the follow- ing primers: 5'-AGGGCGGGGGCATCGGGCACCGGGAT- GGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC- GACAGCAAGCGAACCGGAAT-3'...
Ngày tải lên : 20/06/2014, 01:20
  • 13
  • 463
  • 0
báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot

báo cáo hóa học:" Spontaneous regression of curve in immature idiopathic scoliosis - does spinal column play a role to balance? An observation with literature review" pot

... JYH has contributed in acquisition of data and analysis and interpretation of data; and KPV and NM have contributed in revising the manuscript critically. All authors read and approved the final ... design of data, drafting the manuscript and given the final approval of manuscript, JHY has contributed in acquisition of data, revising the manuscript critically and given the fin...
Ngày tải lên : 20/06/2014, 04:20
  • 8
  • 381
  • 0
Báo cáo hóa học: " Strong consistency of estimators in partially linear models for longitudinal data with mixingdependent structure" pdf

Báo cáo hóa học: " Strong consistency of estimators in partially linear models for longitudinal data with mixingdependent structure" pdf

... sta- tistical inference on the parameters of interest. Hu et al. [25] and Wang et al. [26] took into consideration within-subject correlations for analyzing longitudinal data and obtained some asymptotic ... 2011:112 http://www.journalofinequalitiesandapplications.com/content/2011/1/112 Page 10 of 18 RESEARCH Open Access Strong consistency of estimators in partially linear models for...
Ngày tải lên : 20/06/2014, 22:20
  • 18
  • 405
  • 0

Xem thêm

Từ khóa: