báo cáo hóa học:" Health-related quality of life and physical well-being among a 63-year-old cohort of women with androgenetic alopecia; a Finnish population-based study" pot
Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx
... 5'- GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3' and 5'- CCCGGTACCGTCTGTGTCACAGAGAGAAAGGGAG-3' (for IFN-λ3 promoter), 5'-ATGACGCGTGAAATTCAG- GAGTAATCAGATC-3' and 5'-GAGGTACCCGTAGATATT- GCAGATACTTCTG-3' ... 5'-GTACGGGGATCCTTATCAG- CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'- AAAAAAAAGGATCCACCATG GCACGAATCCTAAACCT- CAAAGA-3', 5'-TTTCCCTG...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Maternal plasma viral load and neutralizing/enhancing antibodies in vertical transmission of HIV: A non-randomized prospective study" ppt
... co-cultured Table 4: Correlation (Spearman) of maternal and infant p24 antigen levels and maternal viral load with maternal and infant p24 antigen Plasma dilution p24 antigen (M vs I) Correlation a log (p-value) b MVL ... maternal viral load with maternal and infant p24 antigen Using Spearman's correlation, we examined the associa- tion between maternal viral load and...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Research Article Meta-Model and UML Profile for Requirements Management of Software and Embedded Systems" pot
... e also implemented directly as a dedicated software program using a software programming language, such as Java. Our requirements management meta-model can be, and has been, implemented as a ... such system parameters, their associations to requirements, and carry out at least simple calculations with them. More demanding analysis must be naturally separated to external analysis t...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Pesticide exposure, risk factors and health problems among cutflower farmers: a cross sectional study Jinky Leilanie Del Prado-Lu" pptx
... formulating an integrated program on safe and healthy work practices. Methodology An initial situational analysis was conducted to investi- gate the nature and method of pesticide use and applica- tion ... sleeves and plastic pants. Re-entering a recently sprayed area has been the cause of a poisoning outbreak in Poland in 2002 after applicators re-entered a contaminated are...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: "Research Article Almost Automorphic and Pseudo-Almost Automorphic Solutions to Semilinear Evolution Equations with Nondense Domain" docx
... N’Gu ´ er ´ ekata, “On the topological structure of almost automorphic and asymptotically almost automorphic solutions of differential and integral equations in abstract spaces,” Nonlinear Analysis: ... R. P. Agarwal, T. Diagana, and E. M. Hern ´ andez, “Weighted pseudo almost periodic solutions to some partial neutral functional differential equations,” Journal of Nonlinear and C...
Ngày tải lên: 21/06/2014, 20:20
báo cáo hóa học: " Associations between Cardiorespiratory Fitness and Health-Related Quality of Life" pdf
... domains of physical, cognitive, emotional, and social health, and is a fundamental assessment in under- standing the health status of a population [10]. The SF- 12v2™ is a generic health status ... Suppl):I54-I63. 3. Lavie CJ, Milani RV: Disparate effects of improving aerobic exercise capacity and quality of life after cardiac rehabilita- tion in young and elderly c...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Does quality of life among breast cancer survivors one year after diagnosis differ depending on urban and non-urban residence? A comparative study" potx
... Atlanta: American Cancer Society, Inc 2008. 2. Australian Institute of Health and Welfare (AIHW), Australasian Association of Cancer Registries (AACR): Cancer in Australia: An overview, 2006. Canberra: ... general measure. J Clin Oncol 1993, 11(3):570-579. 29. Australian Bureau of Statistics (ABS): Australian Standard Classification of Occupations. Canberra: ABS 1997. 30. Australian...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot
... Access Research Enhancing quality of life in older adults: A comparison of muscular strength and power training Jeffrey A Katula* † , W Jack Rejeski and Anthony P Marsh Address: Department of Health & ... self-efficacy, satisfaction with physical function, and satisfaction with life both at baseline and at the 3-month follow-up visit. In addition, the final...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Evaluating the reliability, validity and minimally important difference of the Taiwanese version of the diabetes quality of life (DQOL) measurement" potx
... correlated with the physical domains of the D- 39S (diabetes control and energy and mobility) and RAND-12 PHC than psychological domains of the D-39S (social burden, anxiety and worry, and sexual ... JA: Health-related quality of life deficits associated with diabetes and comorbidities in a Canadian National Population Health Survey. Qual Life Res 2005, 14(5)...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Do quality of life, participation and environment of older adults differ according to level of activity?" pdf
... International Classification of Functioning, Disability and Health WHO: Geneva, Switzerland; 2001. 2. Asakawa T, Koyano W, Ando T, Shibata H: Effects of functional decline on quality of life among ... levels of activity limitations (none, slight to moderate and moderate to severe). Quality of life was estimated with the Quality of Life Index, participation wi...
Ngày tải lên: 18/06/2014, 22:20