... grammars (TSGs) have potential advantages over regular context-free grammars (CFGs), but there is no obvious way to learn these grammars. In particular, learning procedures are not able to take ... EMNLP. Thomas S. Ferguson. 1973. A Bayesian analysis of some nonparametric problems. Annals of Mathe- matical Statistics, 1(2):209–230. Sharon Goldwater, Thomas L. Griffiths, and Mark Johnson. 2...
Ngày tải lên: 17/03/2014, 02:20
... (;ci'many lhnaih !,1'~!! at I)! ll)iBM I.BITNI'71' ABSTRACT The desire to construct robust and portable na- tural language systems has led to research on how a core vocabulary ... relate to semantic criteria? 3. What semantic criteria can be found to de- fine a core vocabulary? Definitions of a core vocabulary "l:here are several ways to define...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter region ... verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively. The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- C...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot
... Computational Linguistics Learning to Win by Reading Manuals in a Monte-Carlo Framework S.R.K. Branavan David Silver * Regina Barzilay Computer Science and Artificial Intelligence Laboratory Massachusetts ... the branch- ing factor is large it is usually beneficial to approx- imate the action-value function, so that the value of many related states and actions can be learned from a reason...
Ngày tải lên: 07/03/2014, 22:20
Essential Academic Learning Requirements: A Recommended Grade-by-Grade Sequence for Grade Level Expectations – Grades K-12 pot
... understanding, and positive attitudes about physical activity so that they can adopt healthy and physically active lifestyles. Quality physical education programs are also important because they ... Twists at the waist. Demonstrates static balance and dynamic balance using a variety of body parts and objects. Example: Balances on knees and one hand. 1.1.3 Demonstrates mature...
Ngày tải lên: 14/03/2014, 20:20
Đề Thi Thử Đại Học Khối A,B Hóa Học 2013 - Phần 14 - Đề 6 potx
... ứng sau, phản ứng nào sai: A. NaHSO 4 + BaCl 2 BaCl 2 + NaCl + HCl B. 2NaHSO 4 + BaCl 2 Ba(HSO 4 ) 2 + 2NaCl C. NaHSO 4 + NaHCO 3 Na 2 SO 4 + H 2 O + CO 2 D. Ba(HCO 3 ) 2 +NaHSO 4 BaSO 4 +NaHCO 3 +H 2 O+CO 2 ... Na C. nước brom, anđehit fomic, dung dịch NaOH D. nước brom, ancol etylic, dung dịch NaOH 033: Cho các chất: etyl axetat, anilin, ancol etylic, axit acrylic, p...
Ngày tải lên: 16/03/2014, 21:20
LEARNING FROM A LEGEND: HOW WARREN MADE HIS BILLIONS pot
... great, although staring at a 1.1 or 1.2 isn’t going to steer me away from a company. How does PEG work? Let’s say a company has a P/E of 12. And that company has projected annual earnings ... who run it. Apart from good management, you’d want quality products and services and a company you understand. Let’s take these one at a time. • Management. Warren puts strong ma...
Ngày tải lên: 23/03/2014, 03:20
Đề Thi Thử Đại Học Khối A, A1, B, D Toán 2013 - Phần 25 - Đề 6 pot
... trụ tam giác đều ABC .A B’C’ có cạnh đáy bằng a. Biết khoảng cách gi a hai đường thẳng AB và A C bằng 15 5 a . Tính thể tích c a khối lăng trụ. Câu V:(1điểm) Tìm m để hệ phương trình sau có ... d 1 ; d 2 và điểm A cùng nằm trong một mặt phẳng. Xác định toạ độ các đỉnh B và C c a tam giác ABC biết d 1 ch a đường cao BH và d 2 ch a đường trung tuyến CM c a tam giác ABC. 2....
Ngày tải lên: 23/03/2014, 15:20
Đề Thi Đại Học Khối A, A1 Vật Lý 2013 - Phần 8 - Đề 6 pot
... chùm tia ló ra ngoài không khí là A: Chùm tia màu vàng B: Ba chùm tia:vàng,lam,tím C:Hai chùm tia màu lam và tím D: hai chùm tia màu vàng và màu lam 7 Câu 36: catot c a tế bào quang điện ... cân bằng. Va chạm gi a hai vật là va chạm mềm →Vận tốc c a hai vật sau va chạm Biên độ dao động ban đầu c a vật Độ giảm biên độ sau một lần qua vị trí cân bằng là: Trong n a chu k...
Ngày tải lên: 24/03/2014, 07:20
Báo cáo "Tổng hợp và hoạt tính độc tế bào của một số dẫn xuất của 4'''',5,6-trihidroxy-3,3'''',7-trimetoxyflavon được phân lập từ cây Miliusa balansae " pot
... 6, 49 s 6, 99 d 7 ,68 dd 7 ,69 d T2i liệu tham khảo 1. Do Thu Huong, Christine Kamperdick, and Tran Van Sung. Homogentisic acid derivatives from Miliusa balansae (Annonaceae), Journal of Natural ... 194 (2000). 7. Tokunaru Horie, Hideaki Tominaga, Isao Yoshida, and Yasuhico Kawamura. Bull. Chem. Soc. Jpn., Vol. 66 , P. 877 - 881 (1993). 8. Hideaki Tominaga and Tokunaru Horie. Bul...
Ngày tải lên: 25/03/2014, 12:21