Accelerate C in FPGA 5 potx

Accelerate C in FPGA_3 potx

Accelerate C in FPGA_3 potx

... overriding it by passing a different CultureInfo instance, such as one obtained by creating a new instance of CultureInfo by passing into its constructor a string representing the desired locale ... types in order to distinguish them from the new collection types and interfaces defined within the System.Collections.Generic and System.Collections.ObjectModel namespaces. Comparing ICollec...

Ngày tải lên: 20/06/2014, 08:20

59 249 0
Accelerate C in FPGA_5 potx

Accelerate C in FPGA_5 potx

... IMyEnumerator<object> collObjects = collStrings; PrintCollection( collObjects, 2 ); } static void PrintCollection( IMyEnumerator<object> coll, int count ) { for( int i = 0; i < count; ... has discussed how to declare and use generics using C# , including generic classes, structs, interfaces, methods, and delegates. I discussed generic constraints, which are nece...

Ngày tải lên: 20/06/2014, 08:20

59 154 0
Accelerate C in FPGA_1 ppt

Accelerate C in FPGA_1 ppt

... main reason for this is so that only the class for the object being copied can call it, because MemberwiseClone can create an object without calling its instance constructor. Such behavior could ... unboxing, which I showed can introduce unintended inefficiencies when you don’t understand all of the places boxing can be introduced by the compiler. (In Chapter 11, which covers generics, ....

Ngày tải lên: 20/06/2014, 08:20

59 212 0
Accelerate C in FPGA_4 pot

Accelerate C in FPGA_4 pot

... System.Collections.Generic; public class EntryPoint { static void Main() { } public void NonGeneric( Stack stack ) { foreach( object o in stack ) { int number = (int) o; Console.WriteLine( ... up a closed instance delegate to an instance method on an object instance, the delegate passes the object instance as the this reference when it calls the instance method. With ope...

Ngày tải lên: 20/06/2014, 08:20

59 183 0
Accelerate C in FPGA_7 pdf

Accelerate C in FPGA_7 pdf

... Object.ToString(): (1.123 456 78 2.123 456 78) In Main, notice the creation and use of two different CultureInfo instances. First, the ComplexNumber is output using American cultural formatting; ... the num1 instance must be boxed in order to acquire a reference to the IComparable interface on it. Secondly, because CompareTo accepts a reference of type System.Object, the num2 instance...

Ngày tải lên: 20/06/2014, 08:20

59 246 0
Accelerate C in FPGA_8 docx

Accelerate C in FPGA_8 docx

... TCollection collection, TCursor cursor, Func<TCollection, TCursor, TItem> getCurrent, Func<TCursor, bool> isFinished, Func<TCursor, TCursor> advanceCursor) { while( !isFinished(cursor) ... the following: using System; unsafe public class MyClosure { public MyClosure( int* counter ) { this.counter = counter; } public delegate int IncDelegate(); pu...

Ngày tải lên: 20/06/2014, 08:20

59 122 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... gene was PCR-amplified from Drosophila genomic DNA using primers 5 -ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5 -TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢. HindIII–BamHI digested PCR product was cloned into the ... primers: 5 -CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5 -GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢. BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd in the pAS2-1 vect...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Tài liệu Đề thi và đáp án tiếng anh trình độ C - Đề 5 potx

Tài liệu Đề thi và đáp án tiếng anh trình độ C - Đề 5 potx

... because it was ________ to be unsinkable. (A) argued (B) claimed (C) believed (D) told 19. This church was ________ by the famous architect, Archbald Sparrow. (A) outlined (B) designed (C) ... game (C) play (D) practice C D (C) swelling (D) bruise 4. This is not the right ________ to ask for my help; I am far too busy even to listen! (A) moment (B) situation (C) opportunity (D) circ...

Ngày tải lên: 25/02/2014, 16:20

8 931 7
The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx

The effect of grammar teaching (syntax) in English on 5 to 16 year olds’ accuracy and quality in written composition potx

... effect of teaching syntax on accuracy and quality in written composition (in 2003-4); the effect of teaching sentence-combining on accuracy and quality in written composition (in 2004 -5) ... (ERIC); PsycINFO; and Social Science Citation Index (SSCI) • citations in reference lists of all included systematic and non-systematic reviews • personal contacts We applied the inclus...

Ngày tải lên: 10/03/2014, 05:20

85 700 1
Sams Teach Yourself iOS 5 Application Development in 24 Hours potx

Sams Teach Yourself iOS 5 Application Development in 24 Hours potx

... hands-on practice working with each. We cover Xcode’s interface-creation tools in Hour 5, “Exploring Xcode’s Interface Builder.” Using Xcode When you think of coding—actually typing the statements ... projects, Objective -C will fade into the background, letting you concentrate on the specifics of your application. Cocoa Touch While Objective -C defines the structure for iOS applications...

Ngày tải lên: 22/03/2014, 21:20

801 1,2K 0
Từ khóa:
w