Accelerate C in FPGA 5 potx

... overriding it by passing a different CultureInfo instance, such as one obtained by creating a new instance of CultureInfo by passing into its constructor a string representing the desired locale ... types in order to distinguish them from the new collection types and interfaces defined within the System.Collections.Generic and System.Collections.ObjectModel namespaces. Comparing ICollec...

Ngày tải lên: 20/06/2014, 08:20

... IMyEnumerator<object> collObjects = collStrings; PrintCollection( collObjects, 2 ); } static void PrintCollection( IMyEnumerator<object> coll, int count ) { for( int i = 0; i < count; ... has discussed how to declare and use generics using C# , including generic classes, structs, interfaces, methods, and delegates. I discussed generic constraints, which are nece...

Ngày tải lên: 20/06/2014, 08:20

... main reason for this is so that only the class for the object being copied can call it, because MemberwiseClone can create an object without calling its instance constructor. Such behavior could ... unboxing, which I showed can introduce unintended inefficiencies when you don’t understand all of the places boxing can be introduced by the compiler. (In Chapter 11, which covers generics, ....

Ngày tải lên: 20/06/2014, 08:20

... System.Collections.Generic; public class EntryPoint { static void Main() { } public void NonGeneric( Stack stack ) { foreach( object o in stack ) { int number = (int) o; Console.WriteLine( ... up a closed instance delegate to an instance method on an object instance, the delegate passes the object instance as the this reference when it calls the instance method. With ope...

Ngày tải lên: 20/06/2014, 08:20

... Object.ToString(): (1.123 456 78 2.123 456 78) In Main, notice the creation and use of two different CultureInfo instances. First, the ComplexNumber is output using American cultural formatting; ... the num1 instance must be boxed in order to acquire a reference to the IComparable interface on it. Secondly, because CompareTo accepts a reference of type System.Object, the num2 instance...

Ngày tải lên: 20/06/2014, 08:20

... TCollection collection, TCursor cursor, Func<TCollection, TCursor, TItem> getCurrent, Func<TCursor, bool> isFinished, Func<TCursor, TCursor> advanceCursor) { while( !isFinished(cursor) ... the following: using System; unsafe public class MyClosure { public MyClosure( int* counter ) { this.counter = counter; } public delegate int IncDelegate(); pu...

Ngày tải lên: 20/06/2014, 08:20

... gene was PCR-amplified from Drosophila genomic DNA using primers 5 -ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5 -TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢. HindIII–BamHI digested PCR product was cloned into the ... primers: 5 -CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5 -GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢. BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd in the pAS2-1 vect...

Ngày tải lên: 21/02/2014, 15:20

... because it was ________ to be unsinkable. (A) argued (B) claimed (C) believed (D) told 19. This church was ________ by the famous architect, Archbald Sparrow. (A) outlined (B) designed (C) ... game (C) play (D) practice C D (C) swelling (D) bruise 4. This is not the right ________ to ask for my help; I am far too busy even to listen! (A) moment (B) situation (C) opportunity (D) circ...

Ngày tải lên: 25/02/2014, 16:20

... effect of teaching syntax on accuracy and quality in written composition (in 2003-4); the effect of teaching sentence-combining on accuracy and quality in written composition (in 2004 -5) ... (ERIC); PsycINFO; and Social Science Citation Index (SSCI) • citations in reference lists of all included systematic and non-systematic reviews • personal contacts We applied the inclus...

Ngày tải lên: 10/03/2014, 05:20

... hands-on practice working with each. We cover Xcode’s interface-creation tools in Hour 5, “Exploring Xcode’s Interface Builder.” Using Xcode When you think of coding—actually typing the statements ... projects, Objective -C will fade into the background, letting you concentrate on the specifics of your application. Cocoa Touch While Objective -C defines the structure for iOS applications...

Ngày tải lên: 22/03/2014, 21:20