báo cáo hóa học:" HIV-1-infected and HIV-1-uninfected adults in Burkina Faso: a cross-sectional study" pptx
Báo cáo hóa học: " Immune and hemorheological changes in Chronic Fatigue Syndrome" pdf
... CFS patients from a community based sample in New South Wales and Queensland, Australia and 10 healthy aged and sex matched participants from a community local area. CFS patients were chosen after ... Scordamaglia F, Balsamo M, Scordamaglia A, Moretta A, Cristina MM, Canonica GW, Moretta L: Perturbations of natural killer cell regulatory functions in respiratory allergic disea...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " Urinary and sexual outcomes in long-term (5+ years) prostate cancer disease free survivors after radical prostatectomy" ppt
... with a higher score indicating better QoL. Statistical analysis We evaluated in the statistical analysis the correlation between function and bother and subject demographic and clinical characteristics ... correlation between follow-up duration and SB and an inverse correlation between age at follow-up and UF. Moreover, pathological stage negatively affected UB, SF, and SB....
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Age and gender differences in seven tests of functional mobility" doc
... control and adjust standing balance may undergo greater age-related changes than transfer and walking tasks. However, it is also possible that the larger age effects may be partly due to familiarisation ... familiarisation factors in that the coordinated stability and near tandem balance tests are less similar to everyday tasks than tests such as the sit to stand and stair negotiati...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Proinflammatory and proapoptotic markers in relation to mono and di-cations in plasma of autistic patients from Saudi Arabia" docx
... Ramos M, Marmol P, del Arco A, Saheki T, Pardo B: Role of aralar, the mitochondrial transporter of aspartate- glutamate, in brain N-acetylaspartate formation and Ca( 2+ ) signaling in neuronal mitochondria. ... may lead to failure of drawing out Ab from the brain across the blood brain barrier (BBB) as a mechanism for Ab accumulation in Saudi autistics [Al-Ayahdi L, Ben Bacha A, K...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Enhancing quality of life in older adults: A comparison of muscular strength and power training" pot
... communities, a data- base containing the names of older adults interested in clinical trials research, and advertisements placed in the local newspaper. We were primarily interested in targeting older adults ... design, data analy- sis, and helped to draft the manuscript, APM participated in the study design and coordination and helped draft the manuscript. All authors r...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx
... study, acquisition of data and analysis and interpretation of data, (ii) drafting of this manuscript and have given final approval of this version for publica- tion. Additional material Acknowledgements We ... the same likelihood of participation restric- tion (examining onset and persistence separately), within strata defined by age, gender, educational attainment, occupational class...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... to falls and instability by increasing their stride-to-stride variability. A small pertur- bation could then take an already unstable system and cause a fall. Regardless of the precise explanation, ... placement, at least during gait termination, may also be increased when lighting is not adequate [12]. These changes are reminiscent of the walking pattern of older adults with a HL...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:"Necessary and sufficient condition for the smoothness of intersection local time of subfractional Brownian motions" docx
... below). For information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about ... R, Lindstrøm, T: Nonstandard Meth- ods in Stochastic Analysis and Mathematical Physics. Academic Press, New York (1986) [15] Bojdecki, T, Gorostiza, LG, Talarczyk, A: Sub-fractional...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaque nucleotide sequence (Genbank Acces- sion ... reverse-5'- GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and rever...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" TRIP-Br2 promotes oncogenesis in nude mice and is frequently overexpressed in multiple human tumors" ppt
... prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, breast carcinoma, gastrointestinal stromal tumor, ovarian cystadenocarcinoma, colorectal carcinoma, basal cell car- cinoma, ... that TRIP-Br2 was also overexpressed in many human cancers, including prostate carcinoma, squamous cell lung carcinoma, lung adenocarcinoma, ovarian cystadenocarcinoma, colorectal carcinoma, ......
Ngày tải lên: 18/06/2014, 15:20