báo cáo hóa học:" Protecting HIV information in countries scaling up HIV services: a baseline study" potx
... RESEARCH Open Access Protecting HIV information in countries scaling up HIV services: a baseline study Eduard J Beck 1* , Sundhiya Mandalia 2 , Guy Harling 1 , Xenophon M Santas 3 , Debra Mosure 3 , ... collection, data storage, data transfer and data access. Responses were analyzed using regression analyses for associations with national HIV prevalence, gross national...
Ngày tải lên: 20/06/2014, 08:20
... maralofrano@gmail.com; Hanna Karen Moreira Antunes - hannakaren@psicobio.epm.br; Wagner Luiz do Prado - wagner.prado@upe.br; Aline de Piano - aline.depiano@gmail.com; Danielle Arisa Caranti - danielle@caranti.com.br; ... revealed a statistically significant decrease in binge eating scores both in girls and boys after a long-term multidisciplinary therapy. These results can be attribu...
Ngày tải lên: 18/06/2014, 18:20
... Claudia Miranda-Castillo - c.miranda@ucl.ac.uk * Corresponding author Abstract Background: A couple of decades ago, hospitals or psychiatric institutions were in charge of caring for patients ... care of the patient [5,16,21,37,39- 42]. Damage in caregiver social life and a lack of social support has lead to caregivers complaints towards treatment deliv- ered by health institutions...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx
... time as a percen- tage of the movement duration (%Dur). Joint angle mathematical characterization and accuracy After data normalization, each joint angula r profile was mathem atically characterized ... 2011) RESEARCH Open Access Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach Ilaria Carpinella 1* , Johanna Jonsdottir 2 and Maurizio F...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "Mortality and morbidity in children caused by falling televisions: a retrospective analysis of 71 cases" pot
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Investigation into Photoconductivity in Single CNF/TiO2-Dye Core–Shell Nanowire Devices" potx
... traps near the sur- face. These hole traps are commonly associated with oxygen vacancies, which can readily occur on the surface as well as at the grain boundaries within the nanocrystal- line/amorphous ... typically remains in the\1–5% range. Many explanations have been proposed for why the above modifications have failed to improve the performance, including an insufficiently large surface...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Whispering gallery modes in photoluminescence and Raman spectra of a spherical microcavity with CdTe quantum dots: anti-Stokes emission and interference effects" ppt
... as three-dimensional optical resonators providing the feedback required for linear and non-linear optical processes such as enhanced Raman scattering [1]. Polymer latex microspheres containing semiconductor quantum ... we have studied the Raman scat- tering from a single CdTe layer on a PS microsphere at different excitation conditions. The measured Raman spectra at resonance excita- tion...
Ngày tải lên: 22/06/2014, 22:20
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf
... inventories: A complex network ap- proach. In COLING-08, pages 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. Dental and alveolar nasals in Dravidian. ... redundancy in the classifica- tory system. This is because, such a distinction is prevalent in many other sounds, some of which are (a) nasals in Tamil (Shanmugam, 197...
Ngày tải lên: 22/02/2014, 02:20
báo cáo sinh học:" Human resource management in the Georgian National Immunization Program: a baseline assessment" pot
... organizational issues as well as train- ing programs at the local levels to enhance human resource management capacity. Issues relating to financial constraints, infrastructure and poor working environment must ... test was used to compare the categorical variables, and ANOVA to compare continuous variables. All indicators were meas- ured and analysed at the individual level. Focus groups Pre...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
... ORF located in 8~26 ACCTCTGCCTAATCATCTC X/preC 40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC 591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein 993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein 1450~1469 ... CCTGCTGGTGGCTCCAGTTC pre-S2 1571~1592 TCCTAGGACCCCTGCTCGTGTT S 1657~1679 ACTTCTCTCAATTTTCTAGGGGG S 2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S 2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT RT 3199~...
Ngày tải lên: 20/06/2014, 01:20