báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

... Central Page 1 of 5 (page number not for citation purposes) Journal of the International AIDS Society Open Access Commentary Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management ... TB Program Collaboration of Programs National HIV Program National HIV Program A Common TB and HIV Paradigm An Alternative TB and HIV Paradigm TB Serv...

Ngày tải lên: 20/06/2014, 08:20

5 470 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese population. ... Candidate-gene approaches have also demonstrated a role for the Idd3 locu s in human celiac disease and RA [25], as well as in T1D [26,27]. Interestingly, neither the Idd3 lo...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf

Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf

... communication range varies and a ects the transmission rate and the link quality, and the user mobility raises major issues. A clear-cut solution at the physical layer would be the maximization of the ... traffic load, when the trafficload is lower than the BAU value, while in case the trafficloadis higher than BAU, then the traffic throughput equals BAU, as it is alrea...

Ngày tải lên: 21/06/2014, 05:20

11 516 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
Báo cáo hóa học: " Research Article Profile-Matching Techniques for On-Demand Software Management in Sensor Networks" potx

Báo cáo hóa học: " Research Article Profile-Matching Techniques for On-Demand Software Management in Sensor Networks" potx

... management and configuration tasks. Based on the available resources at the robot systems, sophisticates soft- ware architectures can be maintained and applied for task allocation and general-purpose ... University of Califor- nia, Santa Cruz, Calif, USA, February 2003. [9] C C. Han, R. Kumar, R. Shea, and M. Srivastava, “Sensor net- work software update management: a surv...

Ngày tải lên: 22/06/2014, 22:20

10 362 0
báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx

báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx

... subjects' hand path evolving away from the desired path and toward an attrac- tor path. Role of haptic and visual training in trajectory learning Both repeated haptic guidance and visual demonstration gradually ... Irvine, CA, USA, 2 Department of Neurology, and Department of Anatomy and Neurobiology, University of California, Irvine, CA, USA and 3 Department of...

Ngày tải lên: 19/06/2014, 10:20

10 405 0
Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx

Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx

... Journal of Mathematical Analysis and Applications, vol. 325, no. 1, pp. 529–541, 2007. 7 B. G. Pachpatte, “On some new inequalities similar to Hilbert’s inequality,” Journal of Mathematical Analysis ... Operator and Applications Xingdong Liu 1 and Bicheng Yang 2 1 Department of Mathematics, Zhaoqing University, Guangdong, Zhaoqing 526061, China 2 Department of Mathematics, G...

Ngày tải lên: 21/06/2014, 07:20

10 334 0
Báo cáo hóa học: " Research Article An Extragradient Approximation Method for Equilibrium Problems and Fixed Point Problems of a Countable Family of Nonexpansive Mappings" docx

Báo cáo hóa học: " Research Article An Extragradient Approximation Method for Equilibrium Problems and Fixed Point Problems of a Countable Family of Nonexpansive Mappings" docx

... 4.3 Rabian Wangkeeree 17 12 K. Aoyama, Y. Kimura, W. Takahashi, and M. Toyoda, “Approximation of common fixed points of a countable family of nonexpansive mappings in a Banach space,” Nonlinear Analysis: ... nonexpansive mappings in Banach spaces and obtained the strong convergence theorem for such scheme. In this paper, motivated by Yao et al. 10, S. Takahashi and W....

Ngày tải lên: 21/06/2014, 23:20

17 324 0
w