... assessed the properties of QK performing ex vivo experiments of vascular reactivity in WKY common carotid rings [12], and then we evalu- ated in vivo the role of this small peptide studying the ang- iogenic ... analysis in the ischemic hindlimb as well as by histology in wounds and Matrigel plugs. Our findings show the proangiogenic properties of QK, sugg...
Ngày tải lên: 18/06/2014, 15:20
... 36:4222-4232. doi:10.1186/1479-5876-8-15 Cite this article as: Herreros-Villanueva et al.: TAp73 is one of the genes responsible for the lack of response to chemotherapy depending on B- Raf mutational status. Journal of Translational ... came to the conclusion that if TAp73 is regulated differently depending on the B-Raf status, this could be a...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... hospital-based sickle cell disease clinic and an urban primary care clinic. We assessed the HRQL and family functioning of both groups of parents utilizing the PedsQL™ Family Impact Module. The ... par- ents and families. We therefore analyzed the following properties of the PedsQL™ Family Impact Module within our population of parents, both with an...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Development and validation of the Treatment Related Impact Measure of Weight (TRIM-Weight)" pdf
... generation in the development of two obesity-specific measures: the Obesity and Weight Loss Quality of Life (OWLQOL) Questionnaire and the Weight -Related Symptom Measure (WRSM). Clin Ther 2002, ... compliance. Conclusion The development and validation o f the Treatment Related Impact Measure- Weight (TRIM -Weight) has been conducted according to well...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Cross-diagnostic validity of the Nottingham health profile index of distress (NHPD)" doc
... Abstract Background: The Nottingham Health Profile index of Distress (NHPD) has been proposed as a generic undimensional 24-item measure of illness-related distress that is embedded in the Nottingham Health Profile ... disease: validity of the PDQ-39 and Nottingham Health Profile. Mov Disord 2003, 18(7):773-783. 5. Wann-Hansson C, Hallberg IR, Risberg B,...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx
... construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey Sarah Stewart-Brown* 1 , Alan Tennant 2 , ... of the scale, the total data set is randomised into two further sets of approximately 50% of cases. Final results concerning the val...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx
... properties of validity for differential diagnosis of neuropathic pain vs non -neuropathic pain for a cut-off value ≥ 4 points in the Spanish version of the DN4 questionnaire, in the overall sample and ... for the diagnosis of neuropathic pain is a total score of 4/ 10. All questions are related to pain which is the claim for c...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... regarding insulin treatment. To assess the appraisal of insulin therapy of persons with type 2 diabetes, we developed the insulin treatment appraisal scale (ITAS) and tested its reliability and ... with the exception of the item pertaining to weight. Here 54% of the insulin- treated agreed that insulin causes weight gain, compared to 23 %...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Higher polymerase activity of a human influenza virus enhances activation of the hemagglutinin-induced Raf/MEK/ERK signal cascade" pot
... by the method of Reed and Muench [40]. Activation and inhibition of the Raf/MEK/ERK signal cascade Activation of the Raf/MEK/ERK signal cascade was achieved by artificial stimulation of MDCK cells ... for citation purposes) Virology Journal Open Access Research Higher polymerase activity of a human influenza virus enhances activation of the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) NP AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) M AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) NS b AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA) a ... sequences NS AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA NS/5'6U AGCAGU AGCA...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Expression and processing of the Hepatitis E virus ORF1 nonstructural polyprotein" potx
... spectrometric identification of a processed fragment. A papain-like cysteine protease is predicted within the ORF1 polyprotein. We present evidence here for the role of a cysteine protease in ORF1 ... Mutagenesis of the proposed cysteine protease domain of ORF1 sug- gested that the HEV protease had no role in ORF1 poly- protein processing. The cleavage of the ~1...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Nonopportunistic Neurologic Manifestations of the Human Immunodeficiency Virus: An Indian Study" pptx
... Central Page 1 of 10 (page number not for citation purposes) Journal of the International AIDS Society Open Access Research article Nonopportunistic Neurologic Manifestations of the Human Immunodeficiency ... objective of this study was to identify and describe in detail the direct neurologic manifestations of HIV-1 in antiretroviral treatment (ART)-naive, HIV-in...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " Air ambulance services in the Arctic 1999-2009: a Norwegian study" pptx
... Seaso- nal variations are shown in Figure 3. Half of all frac- tures occurred in April and August. The male/female ratio was 1.6 (inhabitants at Svalbard have a male/ female ratio of 1.3). Fractures ... such a setting, Svalbard may become an important base for air ambulance services in the Arctic. Air ambulance service is costly and limited in terms of resources, es...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article Recognition of Faces in Unconstrained Environments: A Comparative Study" pptx
... searching a sequence of transformations (in this case a ne transforms and translations) that are applied to a set of images in order to minimize an entropy measure on the set of images. After having ... thermal images that are not always available and that can slow down the recognition process; (iv) unconstrained 4 EURASIP Journal on Advances in Signal Processing several l...
Ngày tải lên: 21/06/2014, 22:20