báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

... CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-depen- dent and FAK-independent fashion Journal of Ovarian Research 2010, 3:15 Received: ... and reproduction in any medium, provided the original work is properly cited. Research CCR9 interactions support ovarian cancer cell surviva...

Ngày tải lên: 20/06/2014, 07:20

8 316 0
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

... 5¢-TCGTATCCAG TGCAGGGTCCGAG GTGCA CTG GATAC GACTCA TA CAG-3¢; and U6-RT, 5¢-GTCGTATCCAGTGCAGGGT CCGAGGTATTCGCACTGGATACGACAAAATATGG AAC-3¢, which can fold to stem–loop structures. The cDNA was used to ... NF-jB1, was found to be upregulated in ovarian cancer tissues. These findings indicate that inhibition of miR-9 in ovarian cancer may contribute to the malignant phenotyp...

Ngày tải lên: 07/03/2014, 00:20

10 413 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt

... (originally from Jackson Laboratories, Bar Harbor, ME) were bred and maintained at the animal facilities at the Washing- ton University School of Medicine. All animal experi- ments and protocols ... 0) and again at day 7 and day 28. Segmental wall motion scoring index (A) , end diastolic volume (B), end systolic volume (C), and ejection fraction (D) were determined. Data points indi...

Ngày tải lên: 18/06/2014, 16:20

13 506 0
báo cáo hóa học:" Acceptable outcome following resection of bilateral large popliteal space heterotopic ossification masses in a spinal cord injured patient: a case report" doc

báo cáo hóa học:" Acceptable outcome following resection of bilateral large popliteal space heterotopic ossification masses in a spinal cord injured patient: a case report" doc

... ossification masses in a spinal cord injured patient: a case report Ramin Espandar* and Babak Haghpanah Abstract Spinal cord injury is a well-known predisposing factor for development of heterotopic ... steroi- dal anti-inflammatory drugs (NSAIDs) as a preventive measure. Indomethacin has been of particular interest. Indomethacin appears to be effective in the primary pre- ve...

Ngày tải lên: 20/06/2014, 04:20

5 322 0
Báo cáo hóa học: " Viable chimaeric viruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions" pdf

Báo cáo hóa học: " Viable chimaeric viruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions" pdf

... Stratagene, La Jolla, CA) and pUC19 (Stratagene), and the RecA- Escherichia coli strains DH5α and JM109 were used in all standard cloning procedures. The E. coli /A. tumefaciens binary vector ... [44,45] and to co-oper- ate with NSP in moving viral DNA out of the nucleus to adjacent cells [46-48]. As others have noted, the roles that CP, NSP, and MP play in intra- and in...

Ngày tải lên: 20/06/2014, 01:20

11 357 0
báo cáo hóa học:" Does metformin affect ovarian morphology in patients with polycystic ovary syndrome? A retrospective cross-sectional preliminary analysis" pot

báo cáo hóa học:" Does metformin affect ovarian morphology in patients with polycystic ovary syndrome? A retrospective cross-sectional preliminary analysis" pot

... hyperinsulinemia and insulin resistance due to the administration of a largely used insulin sensitizing agent, such as metformin, and modification in ovarian morphological features of PCOS patients. In ... levels of insulin growth factor- binding protein-1 (IGF-BP1), increased insulin resistance and increased ovarian 17-hydroxiprogesterone (17-OHP) and androgen respons...

Ngày tải lên: 20/06/2014, 07:20

5 335 0
báo cáo hóa học:" Predictive value of ovarian stroma measurement for cardiovascular risk in polycyctic ovary syndrome: a case control study" pptx

báo cáo hóa học:" Predictive value of ovarian stroma measurement for cardiovascular risk in polycyctic ovary syndrome: a case control study" pptx

... on each patient using a 6.5 MHz transvaginal transducer (Aloka ALPHA 10 PROSOUND (Aloka, Tokyo, Japan): ovarian volume, ovarian area, stromal area , S /A ratio and the number, diameters and distribu- tion ... (Table 3). Analysis of the ultrasound appearance of the ovaries showed that PCOS patients showed had a higher ovarian and stromal volume, stromal area and a higher a...

Ngày tải lên: 20/06/2014, 07:20

7 422 0
báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

báo cáo hóa học:" Assessing the clinical utility of measuring Insulin-like Growth Factor Binding Proteins in tissues and sera of melanoma patients" potx

... melanoma, IGFBP-7 has been shown to attenuate MAPK signaling, resulting in cellular senescence in BRAF mutant melanocytes and apoptosis in BRAF mutant melanoma cells, and data further suggest that ... Chandraratna RA, Cohen P: Com- bination therapy of insulin-like growth factor binding pro- tein-3 and retinoid X receptor ligands synergize on prostate cancer cell apoptosis...

Ngày tải lên: 18/06/2014, 15:20

9 486 0
báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot

báo cáo hóa học:" yuDetecting the percent of peripheral blood mononuclear cells displaying p-STAT-3 in malignant glioma patients" pot

... may lead to continued growth and increased malignancy. In many malignancies, the signal transducer and activator of transcription 3 (STAT-3) plays an integral role in modulating oncogenesis, inhibiting apoptosis, ... Maleci A, La Sala A, Lande R, Ausiello CM: Defective expression of interferon-gamma, granulocyte-macrophage colony-stimulating factor, tumor necrosis factor alpha,...

Ngày tải lên: 18/06/2014, 15:20

9 462 0
Báo cáo sinh học: "Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response to chemotherapy" doc

Báo cáo sinh học: "Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response to chemotherapy" doc

... intravenous cisplatin plus paclitaxel versus moderately high-dose carboplatin followed by intravenous paclitaxel and intraperitoneal cisplatin in small-volume stage III ovarian carcinoma: an intergroup ... treated with carboplatin (3 cases: 1 pri- mary and 2 recurrent), carboplatin and gemcitabine (2 cases), or carboplatin, taxol and gemcitabine (2 cases) were in vitro resistant...

Ngày tải lên: 18/06/2014, 19:20

7 435 0
w