báo cáo hóa học:" Endometriosis-associated ovarian cancer: A tenyear cohort study of women living in the Estrie Region of Quebec, Canada" doc

báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

... shown in C is indicated in D. Similar analysis as in A and B was used, but included only MPTP-treated values and assigned value of 0 for no treatment and 10, 30 and 50 for increasing dosage of valdecoxib. ... TH- and Nissl-stained neurons, COX-2 and Mac-1-stained activated microglia. With all the data ana- lyzed or with only the data from the MPTP-treated ani- mals, we can...

Ngày tải lên: 19/06/2014, 22:20

16 469 0
báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

... Katai H, Yoshimura K, Maruyama K, Sasako M, Sano T: Evaluation of the New International Union Against Cancer TNM stag- ing for gastric carcinoma. Cancer 2000, 88:1796-1800. 24. Bartling B, Hofmann ... postulates that a progression from chronic gastritis to gastric atrophy, intestinal metaplasia (IM), dysplasia, and finally to cancer ('gastritis-dysplasia-carcinoma' sequence) [...

Ngày tải lên: 18/06/2014, 15:20

11 536 0
báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... Qiagen (Valencia, California, USA). The siRNA target sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG- Journal of Translational ... gemcitabine by CHK1 siRNA. In addition, we functionally-validated the combination of gemcitabine and CHK1 inhibitors as a potential treatment for pancreatic cancer p...

Ngày tải lên: 18/06/2014, 15:20

12 348 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... biological discards, are able to differentiate into muscle, fat, bone and cartilage cell lineages. The aim of this study was to isolate, expand, characterize and assess the differentiation potential of MSCs ... 2 Population doubling and karyotypic analysis. Panel A) Results of hFTs lineage in passage two. Panel B) Results of hFTs lineage in passage 11. We observed high rat...

Ngày tải lên: 18/06/2014, 15:20

10 456 0
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... was found in a major population of proliferating MMP-1+ Barrett and EAC cells. Expression of MMP-1 in proliferating (Ki-67+) cells of intestinal metaplasia and in Barrett-associated adenocarcinomas may ... was quantified in EAC with BE, as well as in the associated Barrett’s mucosa, as well as EAC without BE. Quantification of immunoenzymatic staining of IN or tumor...

Ngày tải lên: 18/06/2014, 16:20

11 647 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese ... and state of activation, may not accu- rately reflect the status and behavior of their counterparts localized in the target organ. In this latter regard, there is experimental...

Ngày tải lên: 18/06/2014, 16:20

12 574 0
báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

... such as Thailand, France, UK and Tanzania [5-8]. Untreated dental caries might lead to dental pain and impact daily activities in terms of play, sleep, eating and school activity [9]. In Tanzania, ... by the National Institute for Medical Research in Tanzania and the Regional Committee for Medical Research Ethics and the Norwegian Data Inspectorate. Written and verbal informed c...

Ngày tải lên: 18/06/2014, 19:20

9 442 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

... (i.e., happiness). The clinical relevance of the mediating role of physical activity can be inferred by com- paring the magnitude of the indirect effect to that of the Table 4: Odds ratios and % ... Canada under the authority of the Statistics Act. Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for this study. The researche...

Ngày tải lên: 18/06/2014, 22:20

11 619 0
báo cáo hóa học: " Design considerations for a wearable monitor to measure finger posture" potx

báo cáo hóa học: " Design considerations for a wearable monitor to measure finger posture" potx

... Type A: SS). Again, the sensor is better suited to sensing a change in angle, rather than the magnitude of the change. A calibration relationship was not explored because the magnitude of the ... experimentation that in the flat hand position, the musculature in the hand tends to relax. In the grip position, in contrast, the muscles must main- tain at le...

Ngày tải lên: 19/06/2014, 10:20

10 502 0
báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx

báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx

... demonstration was withheld Figure 3 shows the tracing error as a function of the reach number during the recall cycle. Whether examining haptic training or visual training, there was an increase in ... with the subjects' hand path evolving away from the desired path and toward an attrac- tor path. Role of haptic and visual training in trajectory learning Both repeate...

Ngày tải lên: 19/06/2014, 10:20

10 405 0
w