0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Hóa học - Dầu khí >

báo cáo hóa học:" Endometriosis-associated ovarian cancer: A tenyear cohort study of women living in the Estrie Region of Quebec, Canada" doc

báo cáo hóa học:

báo cáo hóa học: " Cyclooxygenase-2 mediates microglial activation and secondary dopaminergic cell death in the mouse MPTP model of Parkinson''''s disease" pptx

... shown in C is indicated in D. Similar analysis as in A and B was used, but included only MPTP-treated values and assigned value of 0 for no treatment and 10, 30 and 50 for increasing dosage of valdecoxib. ... TH- and Nissl-stained neurons, COX-2 andMac-1-stained activated microglia. With all the data ana-lyzed or with only the data from the MPTP-treated ani-mals, we can see that the number of TH-stained ... [23].Statistical analysisAll data were analyzed using an IBM-based personal com-puter statistical package (SYSTAT 10, SPSS Inc, Chicago,IL). Except for the correlation analyses, all values areexpressed...
  • 16
  • 468
  • 0
báo cáo hóa học:

báo cáo hóa học:" Serum high mobility group box-1 (HMGB1) is closely associated with the clinical and pathologic features of gastric cancer" pptx

... Katai H, Yoshimura K, Maruyama K, Sasako M, Sano T: Evaluation of the New International Union Against Cancer TNM stag-ing for gastric carcinoma. Cancer 2000, 88:1796-1800.24. Bartling B, Hofmann ... postulatesthat a progression from chronic gastritis to gastric atrophy,intestinal metaplasia (IM), dysplasia, and finally to cancer('gastritis-dysplasia-carcinoma' sequence) [14]. In ... standards.Histopathological analysis In non-cancer groups two specimens were obtained from the greater curvature of the antrum and the midpoint of the greater curvature of the gastric body via...
  • 11
  • 536
  • 0
báo cáo hóa học:

báo cáo hóa học:" Synthetic lethal RNAi screening identifies sensitizing targets for gemcitabine therapy in pancreatic cancer" doc

... Qiagen(Valencia, California, USA). The siRNA target sequenceswere as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT;CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C,AACTGAAGAAGCAGTCGCAAGT; CHK1-D, CCCG-Journal of Translational ... gemcitabineby CHK1 siRNA. In addition, we functionally-validated the combination of gemcitabine and CHK1 inhibitors as a potential treatment for pancreatic cancer patients. The preclinical finding ... SA per-formed the validation of gene silencing. DOA, GDB, SA,and MCH were involved in the writing of the manuscript.All authors have read and approved the final version.Additional materialAcknowledgementsWe...
  • 12
  • 348
  • 0
báo cáo hóa học:

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

... biologicaldiscards, are able to differentiate into muscle, fat, bone and cartilage cell lineages. The aim of this study was to isolate, expand, characterize and assess the differentiation potential of MSCs ... 2Population doubling and karyotypic analysis. Panel A) Results of hFTs lineage in passage two. Panel B) Results of hFTs lineage in passage 11. We observed high rates of cell division, with gradual ... Dr. Irina Kerkis for anti-bodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures. Mrs. Constancia Urbani for secretarial assistance. FAPESP/CEPID,...
  • 10
  • 456
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc

... was found in a major population of proliferating MMP-1+ Barrett and EAC cells. Expression of MMP-1 in proliferating (Ki-67+) cells of intestinalmetaplasia and in Barrett-associated adenocarcinomasmay ... was quantified in EAC with BE,as well as in the associated Barrett’s mucosa, as well asEAC without BE. Quantification of immunoenzymaticstaining of IN or tumor cells was performed, analyzingsix ... determined by measur-ing absorbance at 260 nm. The purity of total RNA wasestablished by confirming th at the 260 nm:280 nm ratiowas within a 1.8-2.0 range, indicating that the RNA pre-parations...
  • 11
  • 647
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

... Maruyama T, Nakanishi K,Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic associationbetween the interleukin-2 receptor-alpha gene and mode of onset of type 1 diabetes in the Japanese ... and state of activation, may not accu-rately reflect the status and behavior of theircounterparts localized in the target organ. In this latter regard, there is experimental evidence that the ... Lee I, Watanabe C, Kamanaka M, Shi W, Yoshida K,Sato T, Habu S, Itoh M, et al: Increased T cell autoreactivity in the absence of CD40-CD40 ligand interactions: a role of CD40 in regulatoryT...
  • 12
  • 573
  • 0
báo cáo hóa học:

báo cáo hóa học: " Dental pain, oral impacts and perceived need for dental treatment in Tanzanian school students: a cross-sectional study" docx

... such as Thailand, France, UK and Tanzania[5-8].Untreated dental caries might lead to dental pain andimpact daily activities in terms of play, sleep, eating andschool activity [9]. In Tanzania, ... by the NationalInstitute for Medical Research in Tanzania and the Regional Committee for Medical Research Ethics and the Norwegian Data Inspectorate. Written and verbalinformed consent to participate ... date, dental pain and itspsychosocial consequences pertaining to the child popu-lations of Sub-Saharan Africa has been given little atten-tion in the literature and the relationship of oral...
  • 9
  • 442
  • 0
báo cáo hóa học:

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

... (i.e., happiness). The clinical relevance of the mediating role of physical activity can be inferred by com-paring the magnitude of the indirect effect to that of the Table 4: Odds ratios and % ... Canada under the authority of the Statistics Act. Access to the data wasgranted by Statistics Canada based on a peer-reviewedproposal for this study. The researchers did not haveaccess to any ... used to measure each of the health attributeswhich were included as binary variables in our analyses.And, there is a lack of independence in our categories of Health and Quality of Life Outcomes...
  • 11
  • 619
  • 0
báo cáo hóa học:

báo cáo hóa học: " Design considerations for a wearable monitor to measure finger posture" potx

... Type A: SS). Again, the sensor is better suited tosensing a change in angle, rather than the magnitude of the change. A calibration relationship was not exploredbecause the magnitude of the ... experimentation that in the flathand position, the musculature in the hand tends to relax. In the grip position, in contrast, the muscles must main-tain at least a minimal contraction in order ... over a 24 hourperiod. The glove survived intact and did not impede anyactivities other than showering and tucking in a shirt.Because the sensors are attached to the back of the hand, the palmar...
  • 10
  • 502
  • 0
báo cáo hóa học:

báo cáo hóa học: "Learning to perform a new movement with robotic assistance: comparison of haptic guidance and visual demonstration" pptx

... demonstration was withheldFigure 3 shows the tracing error as a function of the reachnumber during the recall cycle. Whether examining haptictraining or visual training, there was an increase in ... with the subjects' hand pathevolving away from the desired path and toward an attrac-tor path.Role of haptic and visual training in trajectory learningBoth repeated haptic guidance and ... emerged in Feygin's study. A possible reason that visual training was marginally bet-ter than haptic training is that visual sensation is moreaccurate than haptic sensation, and thus haptic...
  • 10
  • 405
  • 0

Xem thêm

Từ khóa: báo cáo môn học hóa dầubáo cáo trường học văn hóa năm 2012báo cáo trường học văn hóaquảng cáo trên báo giấy hoa học tròtrang bìa báo cáo đại học hoa senbáo cáo khoa hoc hóa họcbáo cáo khoa học về hóa họcbáo cáo khoa học mô hình hóa các quá trình xử lý nước thải bằng mạng nơron nhân tạo potxthiết kế bào giảng hoá học 12 nâng caobai tap nang cao hoa hoc 11 ve bao toan electronbáo cáo khoa học ảnh hưởng của chất điều hòa tăng trưởng thực vật và đường saccharose lên dịch nuôi cấy huyền phù tế bào dừa cạn catharanthus roseus pdfbáo cáo khoa học đề mục quot nghiên cứu công nghệ và thiết bị chế biến bán thành phẩm từ hoa quả với quy mô nhỏ và vừa quottuyên tập cac bao cao khoa học hội nghị khoa học địa i apos ahoàng mạnh quân báo cáo khoa học công nghệ đặc điểm văn hóa kiến thức và chiến lược sinh kế của đồng bào dân tộc thiểu số tại đarkrông quảng trịbáo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ