báo cáo hóa học:" Biomechanical investigation of a novel ratcheting arthrodesis nail" pot
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx
... University of Illinois at Urbana-Champaign, Urbana, IL, USA 2 Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, IL, USA 3 Department of Biochemistry, ... reduction of NADP. Phosphite concentrations (labeled or unlabeled) were held at 2 m M and the assay was started by the addition of 2 lgofHis 6 -tagged PTDH in each assay. The...
Ngày tải lên: 23/03/2014, 15:20
báo cáo hóa học:" Feasibility investigation of allogeneic endometrial regenerative cells" pdf
... Imanishi Y, Saito A, Komoda H, Kitagawa-Sakakida S, Miyagawa S, Kondoh H, Ichikawa H, Sawa Y: Allogenic mesenchymal stem cell transplantation has a therapeutic effect in acute myocar- dial infarction ... menstrual blood sample. The volunteers underwent a standard medical history and physical examination, as well as evaluation for malig- nancy, diabetes, heart disease, in addition to CBC...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx
... the mean age of patients was 48.8 years and the average duration of FM was 9 years. In study 1077, the mean age of patients was 50.1 years and the average dura- Table 1: Baseline patient characteristics ... scores before taking study medication up to and including Day1. If fewer than 7 scores are available then baseline consists of all scores that are available. Health and Quality o...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Multinational development of a questionnaire assessing patient satisfaction with anticoagulant treatment: the ''''Perception of Anticoagulant Treatment Questionnaire'''' (PACT-Q©)" docx
... the PACT-Q (Per- ception of Anticoagulant Treatment Questionnaire). The first part was labeled PACT-Q1, and aimed at measuring expectations. The second part was labeled PACT-Q2 and aimed at measuring ... burden of disease and treatment, and anticoagulant treatment satisfaction. Linguistic validation Linguistic validation was performed on the PACT-Q into eleven additional languages (Austra...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Similar promotion of Aβ1-42 fibrillogenesis by native apolipoprotein E ε3 and ε4 isoforms" pptx
... in late-onset Alzhe- imer disease. Proc Natl Acad Sci USA 1993, 90:9649-9653. 2. Holtzman D, Bales K, Tenkova T, Fagan A, Parsadanian M, Sartorius L, Mackey B, Olney J, McKeel D, Wozniak D, Paul ... citation purposes) 13. Iwatsubo T, Odaka , Suzuki N, Mizusawa H, Nukina N, Ihara Y: Visu- alization of A 42(43) and A 40 in senile plaques with end- specific Af3 monoclonals: Evidence that an...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Differential regulation of Aβ42-induced neuronal C1q synthesis and microglial activation" pptx
... Ref C1qB 5'-cgactatgcccaaaacacct-3' 5'-ggaaaagcagaaagccagtg-3' 94°C 1 min 60°C 1 min30 sec 72°C 2 min 35 [61] MCSF 5'-ccgttgacagaggtgaacc-3' 5'-tccacttgtagaacaggaggc-3' 92°C ... 5'-ggaaatcgtgcgtgacatta-3' 5'-gatagagccaccaatccaca-3' 94°C 30 sec 60°C30 sec 72°C 1 min 25 [61] IL-8 5'-gactgttgtggcccgtgag-3' 5'-ccgtcaagctct...
Ngày tải lên: 19/06/2014, 22:20
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... 5¢-CGCGGATCC ACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ ... 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64- C, 5¢-CGCGGATCCGACTCAGTGGATGACCAATCC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTG...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... Lipo-oligo- saccharide of Campylobacter lari type strain ATCC 35221. Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 245–264. 1766 A. D. Cox et al.(Eur. ... Structure of the liberated oligosaccharide and an associated extracellular polysaccharide. Carbohydr. Res. 279, 227– 244. 24. Aspinall, G.O., Monteiro, M .A. & Pan...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relative abundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... 4.91 and 4.62 were attributed to the t-Gal (GalI and GalII), 4-Gal (GalI*), 3-Gal (GalII*) and t-GalNAc (GalNAc) identified by linkage analysis. Signals for the methyl prot...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: Molecular characterization of a novel nuclear transglutaminase that is expressed during starfish embryogenesis ppt
... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG 2459 AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC 2519 TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG 2639 TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT 2699 TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC ....
Ngày tải lên: 08/03/2014, 10:20