báo cáo hóa học:" A technique to remove a well-fixed titanium-coated rm acetabular cup in revision hip arthroplasty" ppt

... as: Judas et al.: A technique to remove a well-fixed titanium-coated rm acetabular cup in revision hip arthroplasty. Journal of Orthopaedic Surgery and Research 2011 6:31. Submit your next manuscript ... extraction of well-fixed acetabular components. In f act, removing a well-fixed cementless cup is not always an easy task as it may lead to significant...

Ngày tải lên: 20/06/2014, 04:20

... well-fixed acetabular components. In f act, removing a well-fixed cementless cup is not always an easy task as it may lead to significant bone loss, particularly in the medial wall of the acetabulum, and ... cup in revision hip arthroplasty Fernando MJ Judas * , Rui F Dias and Francisco M Lucas Abstract A major concern during revision hip arthroplasty is acetabu...

Ngày tải lên: 20/06/2014, 07:20

... scores within each approach, as well as traditional cut-off points (achieving all or mostly good scores for the indicators included within an approach [9]) were analysed. The bio- medical ap proach was ... concerns about increasing expenditure on health and social care in an ageing society. Althoug h there is an awareness that well- being has no clearly defined op posite, and that it is mor...

Ngày tải lên: 20/06/2014, 15:20

... FAM-CTGGT- GACGAGAGGCTTCCTCAGTCC and primers, forward 5'- GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'- GGTGCCTGGTACTAAGGAGCAA-3', were designed using Rhesus macaque nucleotide sequence (Genbank Acces- sion ... reverse-5'- GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM- TCACACATCGGGATCGGTCTC and primers, forward 5'- GTACTGACACACCTGCGAATCAC-3' and reverse-5&apo...

Ngày tải lên: 18/06/2014, 15:20

... molecular pathways leading to QUIN- induced astrocyte apoptosis has the potential for develop- ing agents that reduce glial and neuronal death related to QUIN-toxicity. Development of pharmacological ... of QUIN have been found associated in various neurodegenerative diseases and brain disorders such as ADC [10], Alzheimer's disease [32,33], cerebral malaria [34], and traumatic bra...

Ngày tải lên: 19/06/2014, 22:20

... Processing 3 2. The Finite Zak Transform Zak w as the first to make a systematic study of the transform that bears his name [38]. The Zak transform has several applications in mathematics, quantum ... such as a time-frequency space, one can obtain a sequence representation that is highly localized in that space. This localization facilitates many sequence analysis tasks, including...

Ngày tải lên: 21/06/2014, 08:20

... “Some remarks concerning D-metric spaces,” in Proceedings of the International Conference on Fixed Point Theory and Applications, pp. 189–198, Yokohama, Yokohama, Japan, 2004. 4 Z. Mustafa and B. ... Zarqa, Jordan. References 1 Z. Mustafa and B. Sims, A new approach to generalized metric spaces,” Journal of Nonlinear and Convex Analysis, vol. 7, no. 2, pp. 289–297, 2006. 2 Z. Musta...

Ngày tải lên: 21/06/2014, 17:20

... (2011) [9] Karapinar, E, Sadarangani, K: Corrigendum to “Fixed point theory for cyclic weaker φ-contraction”. [Appl. Math. Lett. Vol.24(6), 822-825.] In Press. (2011) [10] Karapinar, E, Sadarangani, ... below). For information about publishing your research in Fixed Point Theory and Applications go to http://www.fixedpointtheoryandapplications.com/authors/instructions/ For information...

Ngày tải lên: 21/06/2014, 20:20

... reserva- tion nor interference avoidance mechanisms is in place. In order to maintain a fair comparison, the same fair scheduling algorithm (3) as in BB-OFDMA is applied. With ASCA, the score-based ... BSs in a perpendicular street due to better channel gains. efficiency, it may be necessary to maintain a fair distribution of resources to all users. Achieving a balance b...

Ngày tải lên: 21/06/2014, 23:20

... by minimizing the communication overhead, such as adopting data aggregation to reduce data transmission, using data replicas to shorten the data delivery path. Inamultiratequerysystem,adatasourceservingmul- tiple ... records and aggregating raw data, which is re- ferred to as in- network data processing and data aggrega- tion. Since the placement of the data processing function and ope...

Ngày tải lên: 22/06/2014, 19:20