báo cáo hóa học:" A technique to remove a well-fixed titanium-coated rm acetabular cup in revision hip arthroplasty" ppt
báo cáo hóa học:" A technique to remove a well-fixed titanium-coated rm acetabular cup in revision hip arthroplasty" ppt
... as: Judas et al.: A technique to remove a well-fixed
titanium-coated rm acetabular cup in revision hip arthroplasty. Journal
of Orthopaedic Surgery and Research 2011 6:31.
Submit your next manuscript ... extraction of well-fixed
acetabular components. In f act, removing a well-fixed
cementless cup is not always an easy task as it may lead
to significant...
báo cáo hóa học:" A technique to remove a well-fixed titanium-coated rm acetabular cup in revision hip arthroplasty" potx
... well-fixed
acetabular components. In f act, removing a well-fixed
cementless cup is not always an easy task as it may lead
to significant bone loss, particularly in the medial wall
of the acetabulum, and ... cup
in revision hip arthroplasty
Fernando MJ Judas
*
, Rui F Dias and Francisco M Lucas
Abstract
A major concern during revision hip arthroplasty is acetabu...
báo cáo hóa học:" Psychological approach to successful ageing predicts future quality of life in older adults" pdf
... scores
within each approach, as well as traditional cut-off points
(achieving all or mostly good scores for the indicators
included within an approach [9]) were analysed. The bio-
medical ap proach was ... concerns about
increasing expenditure on health and social care in an
ageing society. Althoug h there is an awareness that well-
being has no clearly defined op posite, and that it is mor...
báo cáo hóa học:" Discovery and implementation of transcriptional biomarkers of synthetic LXR agonists in peripheral blood cells" pptx
... FAM-CTGGT-
GACGAGAGGCTTCCTCAGTCC and primers, forward 5'-
GGCAGAATTTAAAACTGCAACACA-3' and reverse-5'-
GGTGCCTGGTACTAAGGAGCAA-3', were designed using
Rhesus macaque nucleotide sequence (Genbank Acces-
sion ... reverse-5'-
GACGCCCGTTTTCTTCTCAG-3'; ABCG1, probe FAM-
TCACACATCGGGATCGGTCTC and primers, forward 5'-
GTACTGACACACCTGCGAATCAC-3' and reverse-5&apo...
báo cáo hóa học: " Quinolinic acid selectively induces apoptosis of human astrocytes: potential role in AIDS dementia complex" ppt
... molecular pathways leading to QUIN-
induced astrocyte apoptosis has the potential for develop-
ing agents that reduce glial and neuronal death related to
QUIN-toxicity. Development of pharmacological ... of QUIN have been found associated in
various neurodegenerative diseases and brain disorders
such as ADC [10], Alzheimer's disease [32,33], cerebral
malaria [34], and traumatic bra...
Báo cáo hóa học: " Review Article Construction of Sparse Representations of Perfect Polyphase Sequences in Zak Space with " ppt
... Processing 3
2. The Finite Zak Transform
Zak w as the first to make a systematic study of the transform
that bears his name [38]. The Zak transform has several
applications in mathematics, quantum ... such as a time-frequency space, one can obtain
a sequence representation that is highly localized in that
space. This localization facilitates many sequence analysis
tasks, including...
Báo cáo hóa học: " Research Article Fixed Point Theory for Contractive Mappings Satisfying Φ-Maps in G-Metric Spaces" ppt
... “Some remarks concerning D-metric spaces,” in Proceedings of the International
Conference on Fixed Point Theory and Applications, pp. 189–198, Yokohama, Yokohama, Japan, 2004.
4 Z. Mustafa and B. ... Zarqa, Jordan.
References
1 Z. Mustafa and B. Sims, A new approach to generalized metric spaces,” Journal of Nonlinear and Convex
Analysis, vol. 7, no. 2, pp. 289–297, 2006.
2 Z. Musta...
Báo cáo hóa học: "Fixed point theory for the cyclic weaker Meir-Keeler function in complete metric spaces" ppt
... (2011)
[9] Karapinar, E, Sadarangani, K: Corrigendum to “Fixed point theory for
cyclic weaker φ-contraction”. [Appl. Math. Lett. Vol.24(6), 822-825.] In
Press. (2011)
[10] Karapinar, E, Sadarangani, ... below).
For information about publishing your research in Fixed Point Theory and Applications go to
http://www.fixedpointtheoryandapplications.com/authors/instructions/
For information...
Báo cáo hóa học: " Research Article Busy Bursts for Trading off Throughput and Fairness in Cellular OFDMA-TDD" pptx
... reserva-
tion nor interference avoidance mechanisms is in place. In
order to maintain a fair comparison, the same fair scheduling
algorithm (3) as in BB-OFDMA is applied. With ASCA, the
score-based ... BSs in a perpendicular street due to better channel
gains.
efficiency, it may be necessary to maintain a fair distribution
of resources to all users. Achieving a balance b...
Báo cáo hóa học: " Research Article An Energy-Efficient Framework for Multirate Query in Wireless Sensor Networks" pptx
... by minimizing the communication
overhead, such as adopting data aggregation to reduce data
transmission, using data replicas to shorten the data delivery
path.
Inamultiratequerysystem,adatasourceservingmul-
tiple ... records and aggregating raw data, which is re-
ferred to as in- network data processing and data aggrega-
tion. Since the placement of the data processing function and
ope...