báo cáo hóa học:" Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized tonic-clonic seizure activity" ppt

báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot

... represented in the AML samples. Intra-individual analysis of the spot patterns showed a high correlation between the sample from peripheral blood and bone marrow (Table 2). On/off-phenomena of the identified ... 2 Detail of the two-dimensional patterns of patient A. Detail of the two-dimensional patterns of patient A. Different expression of sp...

Ngày tải lên: 18/06/2014, 15:20

8 530 0
Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot

Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot

... al.: Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells. Journal of Translational Medicine 2010 8:23. Submit ... Access Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio ver...

Ngày tải lên: 18/06/2014, 16:20

11 688 0
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf

Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf

... Li et al., Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients Journal of Translational Medicine 2010, 8:47 Li et al. Journal of Translational Medicine 2010, ... according to the guidelines of the Medical Ethics committees of the health bureau of Guangdong Province of China. sjTRECs were measured in PBMCs from all 48...

Ngày tải lên: 18/06/2014, 16:20

8 367 0
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx

báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx

... real-time quantification RT-PCR detection of type X collagen mRNA Gene Primer Sequence Type X collagen Forward 5'-AGTGCTGTCATTGATCTCATGGA-3' Reverse 5'-TCAGAGGAATAGAGACCATTGGATT-3' 18S ... Orthopaedic Surgery and Research Open Access Research article Differential expression of type X collagen in a mechanically active 3-D chondrocyte...

Ngày tải lên: 20/06/2014, 00:20

10 546 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC- CGGGTTTATTTCCTAAAAT GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG- GAAATGTTGAATACTCA TACTCTTCCTTTTTC-3'. The linear PCR-generated frag- ments were electroporated into YEbac102, ... pCR2 .1 (Invitrogen) using the follow- ing primers: 5'-AGGGCGGGGGCATCGGGCACCGGGAT- GGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC- GACAGCAAGCGAACCGGAAT-3...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo hóa học: " The incidence of acute encephalitis syndrome in Western industrialised and tropical countries" pdf

Báo cáo hóa học: " The incidence of acute encephalitis syndrome in Western industrialised and tropical countries" pdf

... reported in other studies based in the West [12,36] and in the tropics where JE vaccinations have been used [25]. Incidence rates of acute encephalitis in Western Industrialised countries Most of the ... annual incidence of AES was not defined in the field test version of the Japanese encephalitis surveillance standards [1], pending further informat...

Ngày tải lên: 20/06/2014, 01:20

13 410 0
Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt

Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt

... Access Research The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C Robert Eichler 1,2 , Oliver Lenz 1,3 , Wolfgang Garten* 1 and Thomas ... glycoproteins of enveloped viruses [7]. So far, only viral glycoproteins of the arenavirus family and the glycoprotein of the Crimean-...

Ngày tải lên: 20/06/2014, 01:20

7 363 0
Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx

Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx

... illustration of attachment to C. jejuni strain L4 (Fig. 2a, b). Bacteriophage PV22 interacted with C. jejuni by attachment followed by translocation of the phage to the polar region of the bacterium up to ... jejuni (Fig. 2c). Interestingly, PV22 did not appear to inject its DNA into C. jejuni. The constant of velocity of PV22 adsorption on cells was...

Ngày tải lên: 20/06/2014, 01:20

5 261 0
báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx

báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx

... number of measles virus isolates obtained during 2000 2001Figure 1 Map of Turkey showing province and number of measles virus isolates obtained during 2000 2001. Figure 1. Map of Turkey showing ... isolated in Turkey in 2000 and 2001. Results: Wild-type measles viruses were isolated from 24 cases from five provinces in Turkey during 2001. The...

Ngày tải lên: 20/06/2014, 04:20

5 503 0
báo cáo hóa học:" Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized tonic-clonic seizure activity" ppt

báo cáo hóa học:" Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized tonic-clonic seizure activity" ppt

... method. Int Orthop 2001, 25:396-400. doi:10.1186/1749-799X-5-48 Cite this article as: Sioros et al.: Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized ... TH: Treatment of nonunion of humeral shaft fracture with dynamic compression plate and cancellous bone graft. J Chin Med Assoc 2005, 68:73-6...

Ngày tải lên: 20/06/2014, 04:20

7 349 0
báo cáo hóa học:" Nonoperative treatment of slipped capital femoral epiphysis: a scientific study" ppt

báo cáo hóa học:" Nonoperative treatment of slipped capital femoral epiphysis: a scientific study" ppt

... Hashemi-Nejad A, Catterall A: The management of avascular necrosis after slipped capital femoral epiphysis. J Bone Joint Surg [Br] 2005, 87:1669-1974. 16. Moore RD: Conservative management of ... P: Treatment of slipped upper femoral epiphysis with minimal displacement. J Bone Joint Surg 1938, 20:379-399. 24. MacEwen GD: Advantages and disadvantages of pin fixation in s...

Ngày tải lên: 20/06/2014, 04:20

11 536 0
báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf

báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf

... 2001, 32(8):625-30. doi:10. 1186 /1749-799X-6-57 Cite this article as: Bumbaširević et al.: The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases. Journal of Orthopaedic ... proximal part of the scaphoid in adolescents. J Bone Joint Surg Am 2002, 84 -A( 6):915-20. 18. Dailiana ZH, Zachos V, Varitimidis...

Ngày tải lên: 20/06/2014, 07:20

10 379 0
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc

... B infection in an HIV-positive man with fatal fulminant hepatitis < /b> B: a case report Sabrina Bagaglio 1 , Luca Albarello 2 , Priscilla Biswas 1 , Caterina Uberti-Foppa 1 , Claudio Fortis 1 and ... struc- ture and normal biliary tree. The patient had an acute hep- atitis B profile, being positive for HBsAg and HBeAg, weakly positive for anti-HBc IgM and anti-...

Ngày tải lên: 11/08/2014, 17:21

7 348 0
Từ khóa:
w