báo cáo hóa học:" Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized tonic-clonic seizure activity" ppt
báo cáo hóa học:" High correlation of the proteome patterns in bone marrow and peripheral blood blast cells in patients with acute myeloid leukemia" pot
... represented in the AML samples.
Intra-individual analysis of the spot patterns showed a
high correlation between the sample from peripheral
blood and bone marrow (Table 2). On/off-phenomena of
the identified ... 2
Detail of the two-dimensional patterns of patient A. Detail of the two-dimensional patterns of patient A. Different
expression of sp...
Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot
... al.: Prognostic impact of ZAP-70 expression
in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio
versus percentage of positive cells. Journal of Translational Medicine 2010
8:23.
Submit ... Access
Prognostic impact of ZAP-70 expression in
chronic lymphocytic leukemia: mean fluorescence
intensity T/B ratio ver...
Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf
... Li et al., Decreased level of recent thymic emigrants in
CD4+ and CD8+T cells from CML patients Journal of Translational Medicine
2010, 8:47
Li et al. Journal of Translational Medicine 2010, ... according to the guidelines of the Medical Ethics
committees of the health bureau of Guangdong Province
of China. sjTRECs were measured in PBMCs from all 48...
báo cáo hóa học:" Differential expression of type X collagen in a mechanically active 3-D chondrocyte culture system: a quantitative study" docx
... real-time quantification RT-PCR detection of type X collagen mRNA
Gene Primer Sequence
Type X collagen Forward 5'-AGTGCTGTCATTGATCTCATGGA-3'
Reverse 5'-TCAGAGGAATAGAGACCATTGGATT-3'
18S ... Orthopaedic Surgery and
Research
Open Access
Research article
Differential expression of type X collagen in a mechanically active
3-D chondrocyte...
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
... 5'-CGCATCCGTCGGGAGGCCACAGAAACAAAAC-
CGGGTTTATTTCCTAAAAT
GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCG-
GAAATGTTGAATACTCA
TACTCTTCCTTTTTC-3'. The linear PCR-generated frag-
ments were electroporated into YEbac102, ... pCR2 .1 (Invitrogen) using the follow-
ing primers:
5'-AGGGCGGGGGCATCGGGCACCGGGAT-
GGCCGCCGCGACGGCCGACGATG
AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-
GACAGCAAGCGAACCGGAAT-3...
Báo cáo hóa học: " The incidence of acute encephalitis syndrome in Western industrialised and tropical countries" pdf
... reported in other studies based in the West
[12,36] and in the tropics where JE vaccinations have been
used [25].
Incidence rates of acute encephalitis in Western
Industrialised countries
Most of the ... annual incidence of AES was not defined in the
field test version of the Japanese encephalitis surveillance
standards [1], pending further informat...
Báo cáo hóa học: " The role of single N-glycans in proteolytic processing and cell surface transport of the Lassa virus glycoprotein GP-C" ppt
... Access
Research
The role of single N-glycans in proteolytic processing and cell
surface transport of the Lassa virus glycoprotein GP-C
Robert Eichler
1,2
, Oliver Lenz
1,3
, Wolfgang Garten*
1
and Thomas ... glycoproteins of
enveloped viruses [7]. So far, only viral glycoproteins of
the arenavirus family and the glycoprotein of the
Crimean-...
Báo cáo hóa học: " The ability of flagellum-specific Proteus vulgaris bacteriophage PV22 to interact with Campylobacter jejuni flagella in culture" pptx
... illustration of attachment to C. jejuni strain L4
(Fig. 2a, b). Bacteriophage PV22 interacted with C. jejuni
by attachment followed by translocation of the phage to
the polar region of the bacterium up to ... jejuni
(Fig. 2c). Interestingly, PV22 did not appear to inject its
DNA into C. jejuni.
The constant of velocity of PV22 adsorption on cells was...
báo cáo hóa học:" Genetic characterization of measles viruses isolated in Turkey during 2000 and 2001" potx
... number of measles virus isolates obtained during 2000 2001Figure 1
Map of Turkey showing province and number of measles
virus isolates obtained during 2000 2001.
Figure 1. Map of Turkey showing ... isolated in Turkey in
2000 and 2001.
Results: Wild-type measles viruses were isolated from 24 cases from five provinces in Turkey
during 2001. The...
báo cáo hóa học:" Ilizarov treatment of humeral shaft nonunion in an antiepileptic drug patient with uncontrolled generalized tonic-clonic seizure activity" ppt
... method. Int Orthop 2001, 25:396-400.
doi:10.1186/1749-799X-5-48
Cite this article as: Sioros et al.: Ilizarov treatment of humeral shaft
nonunion in an antiepileptic drug patient with uncontrolled
generalized ... TH: Treatment of nonunion of humeral
shaft fracture with dynamic compression plate and cancellous bone
graft. J Chin Med Assoc 2005, 68:73-6...
báo cáo hóa học:" Nonoperative treatment of slipped capital femoral epiphysis: a scientific study" ppt
... Hashemi-Nejad A, Catterall A: The management of
avascular necrosis after slipped capital femoral epiphysis. J Bone Joint
Surg [Br] 2005, 87:1669-1974.
16. Moore RD: Conservative management of ... P: Treatment of slipped upper femoral epiphysis with minimal
displacement. J Bone Joint Surg 1938, 20:379-399.
24. MacEwen GD: Advantages and disadvantages of pin fixation in s...
báo cáo hóa học:" The treatment of scaphoid nonunion using the Ilizarov fixator without bone graft, a study of 18 cases" pdf
... 2001,
32(8):625-30.
doi:10. 1186 /1749-799X-6-57
Cite this article as: Bumbaširević et al.: The treatment of scaphoid
nonunion using the Ilizarov fixator without bone graft, a study of 18
cases. Journal of Orthopaedic ... proximal part of the scaphoid in adolescents. J Bone Joint
Surg Am 2002, 84 -A( 6):915-20.
18. Dailiana ZH, Zachos V, Varitimidis...
Báo cáo y học: " Virological pattern of hepatitis B infection in an HIV-positive man with fatal fulminant hepatitis B: a case report" doc
... B infection in an HIV-positive man
with fatal fulminant hepatitis < /b> B: a case report
Sabrina Bagaglio
1
, Luca Albarello
2
, Priscilla Biswas
1
, Caterina Uberti-Foppa
1
,
Claudio Fortis
1
and ... struc-
ture and normal biliary tree. The patient had an acute hep-
atitis B profile, being positive for HBsAg and HBeAg,
weakly positive for anti-HBc IgM and anti-...
Từ khóa:
- Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Thơ nôm tứ tuyệt trào phúng hồ xuân hương
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- BT Tieng anh 6 UNIT 2
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật