báo cáo hóa học:" Evaluation of a pig femoral head osteonecrosis model" pdf

... exact locations of arterial branches. Thus, the current pig model can be useful to evaluate blood circulation and pathogenetic alterations of avascular osteonecrosis of human femoral head. We also ... Open Access Evaluation of a pig femoral head osteonecrosis model Ping Zhang 1,2 , Yun Liang 3 , Harry Kim 4 , Hiroki Yokota 1,2* Abstract Background: A major cause...

Ngày tải lên: 20/06/2014, 04:20

... disparate sampling rate and sample data size. For example, the pressure and temperature sampled data may be smaller in size and lower in sampling rate than the real time image data. Finally, ... the gastrointestinal (GI) tract. Cur- rently, the commercial WCE is mainly composed of a camera, a transceiver, and two button batteries [1]. The camera captures image s of the GI tr act and s...

Ngày tải lên: 21/06/2014, 01:20

... Occupational Health Center, Ministry of Health & Medical Education, Tehran, Iran Email: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Mandana Dolati ... Omid Aminian 2 , Mandana Dolati 3 and Maria Mazaheri 4 Address: 1 Department of Occupational Medicine, Faculty of Medicine, Iran University of Medical Sciences, Tehran, Iran, 2 Departmen...

Ngày tải lên: 20/06/2014, 00:20

... this article as: Hiyama et al.: Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using delay and jitter metrics. Human-centric Computing and Information ... 1:3 http://www.hcis-journal.com/content/1/1/3 Page 2 of 14 RESEARCH Open Access Application of a MANET Testbed for horizontal and vertical scenarios: performance evaluation using d...

Ngày tải lên: 21/06/2014, 06:20

... analysis was done using ABI Prism 7700 software for mRNA quantification. Additional statistical analysis was performed to examine assay accuracy and precision using Microsoft Excel. Accu- racy was assessed ... the lack of a reference standard material to estab- lish a true value, assay accuracy, spike and recovery, and LOQ were not examined. Table 3: IFNγ real time RT-PCR accuracy and p...

Ngày tải lên: 18/06/2014, 15:20

... validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell based cytometry assay, we validated a MCP-1 internalization assay. The parame- ters ... of binding was achieved at a concentration of 60–70 nM of AF488-MCP-1. Since the internalization assay is to be used as a measure of pharmacodynamic effect of a CCR2 a...

Ngày tải lên: 18/06/2014, 15:20

... the melanoma-associated Ags identified so far, Melan -A has received particular attention because of its immune dom- inance in HLA -A2 + patients. A large number of T-cell clones generated from HLA -A2 + ... Ricerca Finalizzata 2007 Fasc. N.ACC5/2, Italian Ministry of Health, Ricerca Finalizzata 2007 Fasc.7OAF4, ISS-ACC, Ricerca Finalizzata 2007 Fasc. N.ACC2/R2.6. References 1. Lef...

Ngày tải lên: 18/06/2014, 15:20

... accuracy compared to CA19-9 alone, our study was limited to patients with locally advanced pan- creatic cancer. Although extrapolation of these data to an asymptomatic population as a potential ... Fedarko NS, Jain A, Maitra A, Iacobuzio-Donahue C, Rahman A, Hruban RH, Yeo CJ, Goggins M: Evaluation of oste- opontin as biomarker for pancreatic adenocarcinoma. Cancer Epidemiol Biomar...

Ngày tải lên: 18/06/2014, 15:20

... 36(6):960-7. doi:10.1186/1479-5876-8-69 Cite this article as: Zhao et al.: Evaluation of normalization methods for two-channel microRNA microarrays. Journal of Translational Medicine 2010 8:69. Zhao et al . Journal of Translational Medicine ... method assumes that there is a set of reference miRs that are invariant across a set of samples. Rather than requiring apriorispecific...

Ngày tải lên: 18/06/2014, 16:20

... 30 forward CAAA GCAAAACGCTGCCAATAA, reverse biotinylated- TCCAGTGGCAATAGGAGCTTTC, JO 31 forward TTGTCATGTTAGCCGTGCAGC, reverse biotinylated- CCACCACCACACCCAGGTAA. 50 ng of DNA were amplified in a ... Ikegami H, Awata T, Kawasaki E, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Amemiya S, Kawabata Y, Kurihara S, Tanaka S, Kanazawa Y, Mochizuki M, Ogihara T: The association of CTLA-4...

Ngày tải lên: 18/06/2014, 16:20